Pectate lyase signal sequence

• US 5,846,818 A
• Filed: 06/06/1995
• Issued: 12/08/1998
• Est. Priority Date: 11/01/1985
• Status: Expired due to Term

• Current Assignee: Xoma Technology Ltd. (Xoma Corp.)
• Original Assignee: Xoma Corp.
• Inventors: Liu, Alvin Y., Wilcox, Gary L., Horowitz, Arnold H., Robinson, Randy R., Lei, Shau-Ping, Wall, Randolph, Better, Marc
• Primary Examiner(s): Woodward, Michael P.
• Assistant Examiner(s): ZEMAN, MARY K
• Application Number:
  US08/472,696
• Time in Patent Office: 1,281 Days
• Field of Search: 536/23.4, 536/23.7, 435/320.1, 435/172.3, 435/252.3, 435/252.33, 435/69.1, 435/39.8, 435/39.7, 935/48
• US Class Current: 435/320.1
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: C07K 14/43 Sweetening agents, e.g. thaumatin, monellin
• CPC Class Codes: C07K 16/3046 Stomach, Intestines
• CPC Class Codes: C07K 16/462 Igs containing a variable region (Fv) from one specie and a constant region (Fc) from another
• CPC Class Codes: C07K 2317/24 containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
• CPC Class Codes: C07K 2317/732 Antibody-dependent cellular cytotoxicity [ADCC]
• CPC Class Codes: C07K 2317/734 Complement-dependent cytotoxicity [CDC]
• CPC Class Codes: C07K 2319/00 Fusion polypeptide
• CPC Class Codes: C07K 2319/02 containing a signal sequence
• CPC Class Codes: C07K 2319/034 containing a motif for targeting to the periplasmic space of Gram negative bacteria as a soluble protein, i.e. signal sequence should be cleaved
• CPC Class Codes: C07K 2319/036 targeting to the medium outside of the cell, e.g. type III secretion
• CPC Class Codes: C07K 2319/30 Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/81 for yeasts
• CPC Class Codes: C12N 9/88 Lyases (4.)

Abstract

The invention is directed to the pectate lyase B secretion signal and its use to express operably linked sequences in bacterial hosts.

Claims

1. A purified DNA molecule comprising DNA encoding a pectate lyase pelB secretion signal that is not operably linked to DNA encoding the mature pectate lyase naturally associated with said secretion signal.

2. The purified DNA molecule of claim 1, wherein the amino acid sequence of said secretion signal is MetLysTyrLeuLcuProThrAlaAlaAlaGlyeuLeuLeuLeuAlaAlaGlnProAlaMetAla.

3. The purified DNA molecule of claim 2, wherein the DNA sequence encoding said amino acid sequence is ATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTATTACTCGCTGCCCAACCAGCGATGGCC.

4. A recombinant vector comprising a DNA sequence encoding a pectate lyase pelB secretion signal not operably linked to DNA encoding the mature pectate lyase naturally associated with said secretion signal.

5. The recombinant vector of claim 4, wherein the amino acid sequence of said pelB is MetLysTyrLeuLeuProThrAlaAlaAlaGlyLeuLeuLeuGlnProMetAla.

6. The recombinant vector of claim 5, wherein said DNA sequence of said secretion signal contains at least one restriction enzyme sit allowing insertion of an operably linked gene of interest.

7. The recombinant vector of claim 5, wherein the DNA sequence of said secretion signal is ATGAAATACCTATTGCCTACGGCACCGCTGGATTGTTATTACTCGCTGCCCAACCAGCGATGGCC.

8. A gram-negative bacterial host comprising the recombinant vector of any one of claims 4 or 5-7.

9. The gram-negative bacterial host of claim 8, wherein said host is E. coli.

10. The recombinant vector of any one of claims 4 or 5-7, wherein said vector is a plasmid.

11. A gram-negative bacterial host comprising the recombinant vector of claim 10.

12. The gram-negative bacterial host of claim 11, wherein said host is E. coli.

13. The recombinant vector of any one of claim, 4 or 5-7, wherein said DNA encoding said secretion signal is operably Linked to a promoter.

14. The recombinant vector of claim 13, wherein said promoter is an araBAD promoter.

15. The recombinant vector of claim 13, wherein said promoter is a lac promoter.

16. A gram-negative bacterial host comprising the recombinant vector of claim 13.

17. The gram-negative bacterial host of claim 16, wherein said host is E. coli.

18. A method for producing a protein in a bacterial host, said method comprising,

(a) providing, to said host cell, a DNA encoding a pectate lyase pelB secretion signal operably linked to DNA other than DNA encoding the mature pectate lyase naturally associated with said secretion signal;

(b) culturing said host cell; and

(c) expressing said protein.

19. The method of claim 18, wherein the amino acid sequence of said secretion signal is MetLysTyrLeuLeuProThrAlaAlaAlaGlyLeuLeuLeuAlaAlaAlaGlnProAlaMetAla.

20. The method of claim 19, wherein the DNA sequence encoding said amino acid sequence is ATGAAATACCTATTGCCTACGGCAGAAGCTGGATTGTTATACTCGCTGCCCAACCAGCGATGGCC.

21. The method of any one of claims 18, 19 or 20, wherein said host cell is E. coli.