Enzyme with endo-1,3(4)-.beta.-glucanase activity

• US 6,140,096 A
• Filed: 06/17/1998
• Issued: 10/31/2000
• Est. Priority Date: 05/11/1994
• Status: Expired due to Fees

• Current Assignee: Novozymes A/S (Novozymes)
• Original Assignee: Novo Nordisk A/S
• Inventors: Christgau, Stephan, Olsen, Hans Sejr, Kauppinen, Markus Sakari, Dalb.o slashed.ge, Henrlk, Kofod, Lene Venke, Andersen, Lene Nonboe, Breinholt, Jens
• Primary Examiner(s): Slobodyansky, Elizabeth
• Application Number:
  US09/098,580
• Time in Patent Office: 867 Days
• Field of Search: 435/200, 435/209, 435/254.1, 435/254.11, 435/254.21, 435/254.3, 435/325, 435/410, 536/23.2
• US Class Current: 435/200
• CPC Class Codes: A21D 8/042 with enzymes
• CPC Class Codes: A61K 8/66 Enzymes
• CPC Class Codes: A61Q 11/00 Preparations for care of the teeth, of the oral cavity or of dentures; Dentifrices, e.g. toothpastes; Mouth rinses
• CPC Class Codes: C11D 3/38645 containing cellulase
• CPC Class Codes: C12N 9/244 Endo-1,3(4)-beta-glucanase (3.2.1.6)
• CPC Class Codes: C12Y 302/01006 Endo-1,3(4)-beta-glucanase (3.2.1.6)
• CPC Class Codes: D06M 16/003 with enzymes or microorganisms

Abstract

An enzyme having endo-1,3(4)-β-glucanase activity is described which is encoded by the DNA sequence ATGTGGTCTCCCAAGGTTGCTGCTGCCGTCCTCGCCTTTGTTGGTGCTACCAACGCCT GGCAGCCCCCGACCTACAGCGGCTTCAACTTGGTCTGGACTGACACCTTCGCTGGCAACGGTGGCACTTCTCCTA ACCAGAACAACTGGAACATCATCACCGGAAACTTGAACGTCAACGCCGAGCAGGAGACCTACTCCTCCAGCACC GCCAATGTTCAGCTCAGTGGTGGCAGCACCCTTCAGCTGGTCCCCTGGAGAGACAGCAGCAAGGGAACCAGCAC CTTTGGTGGCTGGACCTCCGGTCGTCTTGAGTCCAAGTACACATTCACTCCCGCGGCCGGCAAGGTCACCCGTCTT GAAGCCGCCATCCGCTTCGGCAGCAACGCTCAGGCCAACAAGCAGGGTATCTGGCCTGCTTTCTGGATGCTGGGT GACTCCCTCCGTCAACCGGGCGGCAGCTGGCCCAACTGTGGTGAGATCGACATCATGGAGACTGTCGACGGCCA GGCTACCGGCCACGGTACCCTTCACTGCGACGTCTACCCCGGCGGTATCTGCAACGAGGGTAACGGTATTGGAGG CCCTGTCAACATCGCCAACGTCAACGACTGGCACGCTTGGCGTGTTGAGATCGACCGCACTCCCAGCAGCTGGCA ATCCGAGACCCTCACCTGGTCCCTCGACGGCACCATCTACTTCCAGATCACTGGCTCTCGCATTGGCAACCAGGG CGTCTGGAACAACATTGCTCACAGCCCCCTCTTCTTCATTCTTAACGTTGCTGTCGGTGGCAACTGGCCTGGCAAC CCCAACAGCGCTACCCTCGATGGCTACGGAAGCATGATGGAGGTTGGCTACGTCGCTCAGTACTCTACCTAA (SEQ ID NO:3).

Claims

1. A DNA construct comprising a DNA sequence encoding an enzyme exhibiting endo-β

-glucanase activity, wherein the DNA sequence is one of;

(a) a DNA sequence comprising the sequence of SEQ ID NO;

3,

(b) a DNA sequence which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO;

4, or

(c) a DNA sequence which hybridizes with the oligonucleotide probe comprising the DNA sequence of (a) under conditions of presoaking in 5×

SSC, prehybridizing for 1 hr at ˜

50°

C. in a solution of 5×

SSC, 5×

Denhardt'"'"'s, 50 mM sodium phosphate, pH 6.8, and 50 μ

g denatured sonicated calf thymus DNA, followed by hybridization in tlle same solution for 18 h at ˜

50°

C., followed by washing three times in 2×

SSC, 0.2% SDS at 50°

C. for 30 minutes.

2. The DNA construct of claim 1, wherein the endoglucanase activity is endo-1,3(4)-β

-glucanase activity.

3. The DNA construct of claim 1, comprising a DNA sequence encoding an enzymne exhibiting endo-1,3(4)-β

-glucannse activity, which DNA sequence comprises the DNA sequences shown in SEQ ID Nos. 1 or 2.

4. DNA construct of claim 1, wherein the DNA sequence encoding an enzymp- exhibiting endo-β

-glucanase activity is obtainable from a mnicroorganism.

5. The DNA construct qf claim 4, wherein the DNA sequence is obtainable from a filamentous fungus or a yeast.

6. DNA construct of claim 5, wherein the DNA sequence is obtainable fom a strain of Trichoderma, Saecharomyces, Aspergillus, Penacillium, FusaInum, Hlumicola Acremonum, Borryrts, or Sclerolium.

7. DNA construct of claim 6, wherein the DNA sequence is obtainable from a strain of Trichoderma.

8. The DNA construct of claim 7, wherein the DNA sequence is obtainable from a strain of Trichodernn hanianum.

9. The DNA construct, of claim 8, wherein the DNA sequence is isolated from a DNA library of Thchoderma harzianwn CBS 243.71.

12. A recombinant expression vector comprising a DNA construct according to claim 1.

13. A cell comprising the DNA construct of claim 1.

14. The cell of claim 13, which is a eukaryotic cell.

15. The cell of claim 14, wherein the eukaryotic cell is a fungal cell.

16. The cell of claim 15, wherein the fungal cell is yeast or filamentous fungi.

17. The cell of claim 16, wherein the cell belongs to a strain of Aspergillus.

18. The cell of claim 17, wherein the cell is a strain of Aspergillus niger or Aspergillus oryzae.

19. A method of producing an enzyme exhibiting endo-β

-glucanase activity, the method comprising culturing the cell of claim 13 under conditions permitting the production of the enzyme, and recovering the enzyme from the culture.

10. A DNA construct comprising a DNA sequence encoding an enzyme exhibiting endo-1,3(4)-β

-glucanase activity, wherein the DNA sequence is obtainable from a strain of Acremonium sp. CBS 265.95 and comprises SEQ ID Nos. 5 and/or 6.

11. DNA construct of claim 10, wherein the DNA sequence is isolated from Saccharomyces cerevisiae NN049006.

20. A DNA construct comprising a DNA sequence encoding an enzyme exhibiting endo-β

-glucanase activity, wherein the DNA sequence comprises the sequence of SEQ ID NO;

3.

21. A DNA construct comprising a DNA sequence encoding an enzyme exhibiting endo-β

-glucanase activity, wherein the DNA sequence encodes a polypeptide comprising the amino acid sequence of SEQ ID NO;

4.

22. An isolated substantially pure culture of Saccharonryces cerevislac NN049006.