Zymogenic nucleic acid detection methods, and related molecules and kits

• US 6,365,724 B2
• Filed: 12/21/2000
• Issued: 04/02/2002
• Est. Priority Date: 03/05/1998
• Status: Expired due to Term

• Current Assignee: Johnson & Johnson Research Pty Ltd. (Johnson & Johnson)
• Original Assignee: Johnson & Johnson Research Pty Ltd. (Johnson & Johnson)
• Inventors: Todd, Alison V., Fuery, Caroline J., Cairns, Murray J.
• Primary Examiner(s): Horlick, Kenneth R.
• Application Number:
  US09/746,985
• Publication Number:
  US 20010001063A1
• Time in Patent Office: 467 Days
• Field of Search: 536/2.32, 536/24.33
• US Class Current: 536/23.2
• CPC Class Codes: C12Q 1/6816 characterised by the detection means C12Q1/6804 takes precedence
• CPC Class Codes: C12Q 1/6823 Release of bound markers
• CPC Class Codes: C12Q 1/6844 Nucleic acid amplification reactions
• CPC Class Codes: C12Q 1/6853 using modified primers or templates
• CPC Class Codes: C12Q 1/686 Polymerase chain reaction [PCR]
• CPC Class Codes: C12Q 1/6867 Replicase-based amplification, e.g. using Q-beta replicase
• CPC Class Codes: C12Q 2521/337 Ribozyme
• CPC Class Codes: C12Q 2525/149 incorporating a coding sequence
• CPC Class Codes: C12Q 2525/161 incorporating target specific and non-target specific sites
• CPC Class Codes: C12Q 2531/113 PCR
• CPC Class Codes: C12Q 2531/125 Rolling circle
• CPC Class Codes: C12Q 2537/143 Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
• CPC Class Codes: C12Q 2545/114 involving a quantitation step
• CPC Class Codes: C12Q 2563/125 the label being enzymatic, i.e. proteins, and non proteins, such as nucleic acid with enzymatic activity

Abstract

This application provides methods of detecting and quantitatively determining a target nucleic acid sequence in a sample, which comprise contacting the sample with a primer and a zymogene which encodes, but which itself is the anti-sense sequence of, a catalytic nucleic acid sequence, so that when the target is present, a single amplified nucleic acid molecule is produced which comprises the sequences of both the target and catalytic molecules. This invention further provides a method of simultaneously detecting the presence of a plurality of target nucleic acid sequences in a sample. Finally, this invention provides molecules and kits for practicing the instant methods.

Claims

1. A composition of matter for amplifying a nucleic acid molecule of interest, which composition comprises

(a) a first DNA molecule comprising a primer and a DNAzyme-encoding zymogene, wherein (i) the DNAzyme is a 10-23 DNAzyme, and (ii) the primer is situated 3′

of the zymogene, and

(b) a second DNA molecule comprising a primer having at least one purine ribonucleotide residue which serves as the 5′

side of the site recognized and cleaved in cis by the DNAzyme,

wherein the primer on the first DNA molecule initiates amplification of a strand of the nucleic acid molecule which is complementary to the strand amplified by the primer on the second DNA molecule.

2. The DNA molecule of claim 1, wherein the primer on the second DNA molecule further comprises a ribonucleotide residue that serves as the 3′

side of the site recognized and cleaved in cis by the DNAzyme.

3. A composition of matter for amplifying a nucleic acid molecule of interest, which composition comprises

(a) a first DNA molecule comprising a primer and a DNAzyme-encoding zymogene, wherein (i) the DNAzyme is a 10-23 DNAzyme, and (ii) the primer is situated 3′

of the zymogene, and

(b) a second DNA molecule comprising a primer,

wherein the primer on the first DNA molecule initiates amplification of a strand of the nucleic acid molecule which is complementary to the strand amplified by the primer on the second DNA molecule.

4. A DNA molecule comprising a primer and a DNAzyme-encoding zymogene, wherein the primer is situated 3′

of the zymogene and is complementary to a nucleic acid sequence from an organism found in a water, food or soil sample.

5. A DNA molecule comprising a primer and a DNAzyme-encoding zymogene, wherein the primer is situated 3′

of the zymogene and is complementary to a nucleic acid sequence from an organism selected from the group consisting of animal, plant, bacterium, virus and micoplasma.

6. The DNA molecule of claim 5, wherein the animal is selected from the group consisting of mouse, rat, dog, guinea pig, ferret, rabbit and primate.

7. The DNA molecule of claim 6, wherein the primate is a human.

8. A DNA molecule comprising a primer and a DNAzyme-encoding zymogene, wherein (i) the primer is situated 3′

of the zymogene, and (ii) the DNA molecule is useful for diagnosing in a subject a disorder selected from the group consisting of cancer, cystic fibrosis, hemoglobinopathy, AIDS, hepatitis C and tuberculosis.

9. The DNA molecule of claim 8, wherein the subject is a human.

10. The DNA molecule of claim 9, wherein the primer is complementary to the K-ras gene and the DNAzyme is a 10-23 DNAzyme.

11. The DNA molecule of claim 10 selected from the group consisting of

(a) 5′

GAGAACTGCAATTCGTTGTAGCTAGCCTTTCAGGACCCACGTCCACAAAATGATTCTGA 3′

(SEQ ID NO;

     2);

(b) 5′

CCACTCTCGTTGTAGCTAGCCTATTAGCTGTATCGTCAAGCCACTCTTGC 3′

(SEQ ID NO.

     8); and

(c) 5′

ACTTGTGGTAGTTGGATCGTTGTAGCTAGCCCTGGTGGCAGCTGTATCGTCAAGGCACTC 3′

(SEQ ID NO;

     10).