Method for rapid generation of mature dendritic cells

• US 7,354,909 B2
• Filed: 08/13/2002
• Issued: 04/08/2008
• Est. Priority Date: 08/14/2001
• Status: Expired due to Term

• Current Assignee: The United States of America As Represented By The Secretary of Agriculture
• Original Assignee: The United States of America As Represented By The Secretary of Agriculture
• Inventors: Klinman, Dennis M., Gursel, Mayda, Verthelyi, Daniela
• Primary Examiner(s): LI, QIAN JANICE
• Application Number:
  US10/486,755
• Publication Number:
  US 20040241841A1
• Time in Patent Office: 2,065 Days
• Field of Search: None
• US Class Current: 514/44.00R
• CPC Class Codes: A61K 2039/5158 Antigen-pulsed cells, e.g. T-cells
• CPC Class Codes: A61K 2039/55561 CpG containing adjuvants; Oligonucleotide containing adjuvants
• CPC Class Codes: A61K 39/39 characterised by the immunostimulating additives, e.g. chemical adjuvants
• CPC Class Codes: A61K 39/4615 Dendritic cells
• CPC Class Codes: A61K 39/4622 Antigen presenting cells
• CPC Class Codes: A61K 39/4644 Cancer antigens
• CPC Class Codes: A61K 39/46482 Clostridium, e.g. Clostridium tetani
• CPC Class Codes: C12N 2501/056 Immunostimulating oligonucleotides, e.g. CpG
• CPC Class Codes: C12N 5/0639 Dendritic cells, e.g. Langherhans cells in the epidermis

Abstract

Novel methods for rapidly generating dendritic cells are disclosed herein. The methods include contacting a dendritic cell precursor with a D ODN to generate a mature dendritic cell. In one specific, non/limiting example, the method includes contacting the dendritic cell precursor or the mature dendritic cell with an antigen. The methods are of use both in vitro and in vivo.

Claims

1. A method for generating a mature dendritic cell, comprising

contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising a sequence represented by the following formula:

5′

X₁X₂X₃Pu₁Py₂CpGPu₃Py₄X₄X₅X₆(W)_M(G)_N−

3′

wherein the central CpG motif is unmethylated, Pu is a purine nucleotide, Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any integer from 0 to 10, and N is any integer from 4 to 10, wherein X₁X₂X₃ Pu₁Py₂ and Pu₃Py₄X₄X₅X₆ are self complementary, thereby generating a mature dendritic cell.

4. The method of claim 1, further comprising contacting the dendritic cell precursor with an antigen.

5. The method of claim 1, wherein the oligodeoxynucleotide is modified to prevent degradation.

6. The method of claim 1, wherein the oligodeoxynucleotide has a phosphate backbone modification.

7. The method of claim 6, wherein the phosphate backbone modification is a phosphorothioate backbone modification.

8. The method of claim 1, wherein the oligodeoxynucleotide comprises 100 nucleotides or less.

9. The method claim 8, wherein the oligodeoxynucleotide comprises 50 nucleotides or less.

11. The method according to claim 1, wherein the dendritic cell precursor is a monocyte.

12. The method of claim 1, further comprising contacting the dendritic cell precursor with an agent that enhances dendritic cell maturation.

13. The method according to claim 12, wherein the agent is GM-CSF, IL-4, flt-3L or a combination thereof.

14. The method of claim 1, wherein the dendritic cell precursor is in vivo.

15. The method of claim 1, wherein the dendritic cell precursor is in vitro.

26. A method for generating an activated T lymphocyte, comprising:

producing a mature antigen presenting dendritic cell according to the method of claim 1; and

contacting the mature antigen presenting dendritic cell with a T lymphocyte in vitro, thereby producing an activated T lymphocyte.

27. A method of producing an immune response against an antigen in a subject, comprising

producing mature antigen presenting dendritic cells according the method of claim 1;

contacting the mature antigen presenting dendritic cell with a T lymphocyte in vitro; and

administering a therapeutically effective amount of the activated lymphocytes to the subject,

thereby producing the immune response against the antigen in the subject.

28. The method of claim 1, wherein the dendritic cell precursor is not contacted with another mobilization agent.

29. The method of claim 1, wherein N is 6.

30. The method of claim 1, wherein Pu₁ Py₂ CpG Pu₃ Py₄ comprises phosphodiester bases.

31. The method of claim 30, wherein Pu₁ Py₂ CpG Pu₃ Py₄ are phosphodiester bases.

32. The method of claim 30, wherein X₁X₂X₃ and X₄X₅X₆(W)_M(G)_N comprise phosphodiester bases.

33. The method of claim 30, wherein X₁X₂X₃ comprises one or more phosphothioate bases.

34. The method of claim 30, wherein X₄X₅X₆(W)_M(G)_N comprises one or more phosphothioate bases.

49. The method of claim 1, wherein the oligodeoxynucleotide comprises 18 to 30 nucleotides.

50. The method of claim 4, wherein the antigen is a protein, a polypeptide, a polysaccharide, a DNA molecule, a RNA molecule, a whole cell lysate, an apoptotic cell, or any combination thereof.

51. The method of claim 4, wherein the dendritic cell precursor is contacted with the oliogodeoxynucleotide and the antigen sequentially.

52. The method of claim 4, wherein the dendritic cell precursor is contacted with the oliogodeoxynucleotide and the antigen simultaneously.

2. A method for generating a mature dendritic cell, comprising

contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising a sequence represented by the following formula:

5′

X₁X₂X₃Pu₁Py₂CpGPu₃Py₄X₄X₅X₆(W)_M(G)_N−

3′

wherein the central CpG motif is unmethylated, Pu is a purine nucleotide, Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any integer from 0 to 10, and N is any integer from 4 to 10, wherein X₁X₂X_{3 AND} X₄X₅X₆ are self complementary, thereby generating a mature dendritic cell.

10. The method of claim 2, wherein the oligodeoxynucleotide comprises 18 to 30 nucleotides.

16. The method of claim 2, further comprising contacting the dendritic cell precursor with an antigen for a time sufficient to allow the antigen to be presented on the mature dendritic cell;

thereby producing a mature antigen-presenting dendritic cell.

17. The method of claim 16, wherein the antigen is a protein, a polypeptide, a polysaccharide, a DNA molecule, a RNA molecule, a whole cell lysate, an apoptotic cell, or any combination thereof.

18. The method of claim 16, wherein the dendritic cell precursor is in vivo.

19. The method of claim 2, wherein the dendritic cell precursor is in vitro.

20. The method of claim 2, further comprising contacting the dendritic cell precursor with an agent that enhances dendritic cell maturation.

21. The method according to claim 20 wherein the agent is GM-CSF, IL-4, flt-3 ligand, or a combination thereof.

22. The method of claim 20, wherein the dendritic cell precursor is contacted with the oliogodeoxynucleotide and the antigen sequentially.

23. The method of claim 20, wherein the dendritic cell precursor is contacted with the oliogodeoxynucleotide and the antigen simultaneously.

35. The method of claim 2, wherein N is 6.

36. The method of claim 35, wherein Pu₁ Py₂ CpG Pu₃ Py₄ comprises phosphodiester bases.

37. The method of claim 36, wherein Pu₁ Py₂ CpG Pu₃ Py₄ are phosphodiester bases.

38. The method of claim 36, wherein X₁X₂X₃ and X₄X₅X₆(W)_M(G)_N comprise phosphodiester bases.

39. The method of claim 36, wherein X₁X₂X₃ comprises one or more phosphothioate bases.

40. The method of claim 36, wherein X₄X₅X₆(W)_M(G)_N comprises one or more phosphothioate bases.

41. The method of claim 2, wherein the oligodeoxynucleotide is modified to prevent degradation.

42. The method of claim 2, wherein the oligodeoxynucleotide has a phosphate backbone modification.

43. The method of claim 42, wherein the phosphate backbone modification is a phosphorothioate backbone modification.

44. The method of claim 2, wherein the oligodeoxynucleotide comprises 100 nucleotides or less.

45. The method of claim 44, wherein the oligodeoxynucleotide comprises 50 nucleotides or less.

46. The method of claim 2, wherein the dendritic cell precursor is a monocyte.

3. A method for generating a mature dendritic cell, comprising

contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising the sequence

GGTGCATCGATGCAGGGGGG (SEQ ID NO:

1);

or

GGTGCACCGGTGCAGGGGGG (SEQ ID NO;

2).

24. The method of claim 3, wherein the dendritic cell precursor is in vivo.

25. The method of claim 3, wherein the dendritic cell precursor is in vitro.

53. The method of claim 3, wherein the oligodeoxynucleotide consists of the nucleic acid sequence GGTGCATCGATGCAGGGGGG (SEQ ID NO:

1) or the nucleotide sequence GGTGCACCGGTGCAGGGGGG (SEQ ID NO;

2).

47. A method for generating an activated T lymphocyte, comprising:

contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising a sequence represented by the following formula;

5′

X₁X₂X₃Pu₁Py₂CpGPu₃Py₄X₄X₅X₆(W)_M(G)_N−

3′

wherein the central CpG motif is unmethylated, Pu is a purine nucleotide, Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any integer from 0 to 10, and N is any integer from 4 to 10, wherein X₁X₂X_{3 AND} X₄X₅X₆ are self complementary, thereby generating a mature antigen presenting dendritic cell; and

contacting the mature antigen presenting dendritic cell with a T lymphocyte in vitro, thereby producing an activated T lymphocyte.

48. A method of producing an immune response against an antigen in a subject, comprising:

contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising a sequence represented by the following formula;

5′

X₁X₂X₃Pu₁Py₂CpGPu₃Py₄X₄X₅X₆(W)_M(G)_N−

3′

wherein the central CpG motif is unmethylated, Pu is a purine nucleotide, Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any integer from 0 to 10, and N is any integer from 4 to 10, wherein X₁X₂X_{3 AND} X₄X₅X₆ are self complementary, thereby generating a mature antigen presenting dendritic cell.