Method and kit for molecular identification of smallpox

• US 7,491,493 B2
• Filed: 04/19/2004
• Issued: 02/17/2009
• Est. Priority Date: 04/17/2003
• Status: Active Grant

• Current Assignee: Allen Grolla, Markus Czub
• Original Assignee: Allen Grolla, Markus Czub
• Inventors: Czub, Markus, Grolla, Allen
• Primary Examiner(s): Chunduru; Suryaprabha
• Application Number:
  US10/553,453
• Publication Number:
  US 20070054263A1
• Time in Patent Office: 1,765 Days
• Field of Search: 435/6, 435/91.2, 536/24.33
• US Class Current: 435/6.16
• CPC Class Codes: C12Q 1/683 involving restriction enzymes, e.g. restriction fragment length polymorphism [RFLP]
• CPC Class Codes: C12Q 1/701 Specific hybridization probes

Abstract

Novel PCR based assays to detect Orthopoxvirus DNA have been developed which when tested under simulated clinical conditions have proven to be very sensitive, rapid and robust. Furthermore, artificial templates have been constructed which can be used as positive controls in the RFLP analysis necessary to differentiate variola and monkeypox viruses from the Orthopoxvirus species that normally cause relatively insignificant disease in man. These assays will provide a lab that has already undertaken the isolation of DNA from a patient sample in biocontainment with a sensitive and controlled assay for the detection and differentiation of human-tropic orthopox viruses.

Claims

1. A method of detecting and identifying an orthopoxvirus within a sample comprising:

adding to the sample reagents for nucleic acid amplification and at least one pair of primers capable of amplifying at least one region of the orthopoxvirus genome, said pair of primers being selected from the group consisting of 12 or more consecutive nucleotides of ATGCCGGTACTTATGTATGTGC (SPOXHA5, SEQ ID NO;

     1) and 12 or more consecutive nucleotides of TCTTGTCTGTTGTGGATTCT (SPOXHA3, SEQ ID NO;

     2) when said region of the orthopoxvirus genome is gene HA; and

12 or more consecutive nucleotides of TACCGGTCTCAGCGAATC (SPOXcrmB5, SEQ ID NO;

     3) and 12 or more consecutive nucleotides of ACCGTCTCCGAATGCGGCAT (SPOXcrmB3, SEQ ID NO;

     4) when said region of the orthopoxvirus genome is gene crmB;

incubating the sample under conditions suitable for nucleic acid amplification thereby producing an amplicon if the sample contains orthopoxvirus;

adding at least one restriction enzyme selected from the group consisting of;

Sau 3AI, Spe I, Dra I, Hpa I, Ssp I, Alw 44I, Nla III, and combinations thereof; and

determining if restriction enzyme digestion of an amplicon has occurred.

2. The method according to claim 1 wherein restriction enzyme digestion of an amplicon is determined by gel electrophoresis.

3. The method according to claim 1 wherein the orthopoxvirus is identified based on the restriction enzyme digestion pattern.