Methods and compositions for phenotype identification based on nucleic acid methylation

• US 7,608,394 B2
• Filed: 07/09/2004
• Issued: 10/27/2009
• Est. Priority Date: 03/26/2004
• Status: Active Grant

• Current Assignee: Sequenom Incorporated (Laboratory Corporation Of America Holdings)
• Original Assignee: Sequenom Incorporated (Laboratory Corporation Of America Holdings)
• Inventors: van den Boom, Dirk Johannes, Ehrich, Mathias
• Primary Examiner(s): Horlick; Kenneth R.
• Assistant Examiner(s): Babic; Christopher M.
• Application Number:
  US10/888,359
• Publication Number:
  US 20060210992A1
• Time in Patent Office: 1,936 Days
• Field of Search: None
• US Class Current: 435/6.12
• CPC Class Codes: C12Q 1/6883 for diseases caused by alterations of genetic material
• CPC Class Codes: C12Q 2600/154 Methylation markers

Abstract

Methods and compositions for identifying an unknown phenotype of a tissue that correlates with changes in the methylation state of the tissue comprising, nucleic acid sample from the tissue with a reagent that modifies unmethylated cytosine to produce uracil, amplifying the nucleic acid target gene region using at least one primer that hybridizes to a strand of said nucleic acid target gene region to produce amplified nucleic acids, determining the characteristic methylation state of the nucleic acid target gene region by base specific cleavage and identification of methylation sites and comparing the ratio of methylated cytosine to unmethylated cytosine for each methylation site of the nucleic acid target gene region to the ratio of methylated cytosine to unmethylated cytosine for each methylation site of a tissue nucleic acid sample of the same type having a known phenotype thereby identifying the unknown phenotype.

Claims

1. A method for determining the susceptibility of a human subject to lung cancer, which comprises:

a. identifying the methylation state of SerpinB5 methylation sites in a nucleic acid from the human subject by a process that comprises (i) amplifying the nucleic acid with polynucleotide primers having nucleotide sequences

TGGAGGTTTTTTGGAAGTTGTGTAG (SEQ ID NO;

     30) and

AAAAAATCACCAACCCTACTACCCC (SEQ ID NO;

     78)

 

thereby generating an amplification product, and (ii) assessing the methylation sites in the amplification product; and

b. determining the susceptibility of the subject to lung cancer based on the methylation state identified in (a).

2. The method of claim 1, wherein the nucleic acid is contacted with a reagent that modifies unmethylated cytosine to produce uracil.

3. The method of claim 2, wherein the reagent is bisulfite.

4. The method of claim 2, wherein the nucleic acid is amplified after it is contacted with the reagent.

5. The method of claim 4, wherein the sequence of the amplification product is determined.

6. The method of claim 1, wherein the methylation state is the percentage of methylated nucleotides in the nucleic acid.

7. A method for confirming the diagnosis of lung cancer in a human subject, which comprises:

a. determining the methylation state of SerpinB5 methylation sites in a nucleic acid from a human subject diagnosed with lung cancer by a process that comprises (i) amplifying the nucleic acid with polynucleotide primers having nucleotide sequences

TGGAGGTTTTTTGGAAGTTGTGTAG (SEQ ID NO;

     30) and

AAAAAATCACCAACCCTACTACCCC (SEQ ID NO;

     78)

 

thereby generating an amplification product, and (ii) assessing the methylation sites in the amplification product; and

b. confirming the diagnosis of lung cancer based on the methylation state determined in (a).

8. The method of claim 7, wherein the nucleic acid is contacted with a reagent that modifies unmethylated cytosine to produce uracil.

9. The method of claim 8, wherein the reagent is bisulfite.

10. The method of claim 8, wherein the nucleic acid is amplified after it is contacted with the reagent.

11. The method of claim 10, wherein the sequence of the amplification product is determined.

12. The method of claim 7, wherein the methylation state is the percentage of methylated nucleotides in the nucleic acid.