Immunostimulatory oligonucleotide that induces interferon alpha

• US 7,718,623 B2
• Filed: 02/25/2005
• Issued: 05/18/2010
• Est. Priority Date: 02/27/2004
• Status: Active Grant

• Current Assignee: Sumiko Iho
• Original Assignee: Emori & Company Limited (KOWA Company Limited), University of Fukui
• Inventors: Iho, Sumiko, Kitagawa, Harukazu, Yamamoto, Saburo, Matsuki, Takasumi
• Primary Examiner(s): EPPS -SMITH, JANET L
• Application Number:
  US10/590,761
• Publication Number:
  US 20070179101A1
• Time in Patent Office: 1,908 Days
• Field of Search: None
• US Class Current: 514/44.00R
• CPC Class Codes: A61K 2039/55561 CpG containing adjuvants; Oligonucleotide containing adjuvants
• CPC Class Codes: A61K 39/39 characterised by the immunostimulating additives, e.g. chemical adjuvants
• CPC Class Codes: A61K 45/06 Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• CPC Class Codes: A61P 1/16 for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• CPC Class Codes: A61P 11/02 Nasal agents, e.g. decongestants
• CPC Class Codes: A61P 11/06 Antiasthmatics
• CPC Class Codes: A61P 17/00 Drugs for dermatological disorders
• CPC Class Codes: A61P 17/02 for treating wounds, ulcers, burns, scars, keloids, or the like
• CPC Class Codes: A61P 17/04 Antipruritics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: A61P 31/06 for tuberculosis
• CPC Class Codes: A61P 31/10 Antimycotics
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 37/04 Immunostimulants
• CPC Class Codes: A61P 37/08 Antiallergic agents antiasthmatic agents A61P11/06; ophthalmic antiallergics A61P27/14
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Abstract

An immunostimulatory oligonucleotide that is represented by the general formula 5′-Gm-GACGATCGTC-Gn-3′ or 5′-Gm-CACGATCGTG-Gn-3′ (in the formula, m and n are each independently an integer from 1 to 9 and m+n=10) and that comprises any of the following base sequences: GGACGATCGTCGGGGGGGGG (SEQ. ID. NO.: 1), GGGACGATCGTCGGGGGGGG (SEQ. ID. NO.: 2), GGGGACGATCGTCGGGGGGG (SEQ. ID. NO.: 3), GGGGGGGACGATCGTCGGGG (SEQ ID NO: 4), GGGGGGGGACGATCGTCGGG (SEQ. ID. NO.: 5), GGGGGGGGGACGATCGTCGG (SEQ. ID. NO.: 6), GGGGGGGGGGACGATCGTCG (SEQ. ID. NO.: 7), and GGGGGGGGGCACGATCGTGG (SEQ. ID. NO.: 8).

Claims

1. An immunostimulatory oligonucleotide that consists of the following base sequence:

GGGGGGGGGGACGATCGTCG (SEQ ID NO;

     19).

2. A pharmaceutical formulation comprising as an active ingredient an immunostimulatory oligonucleotide consisting of the base sequence GGGGGGGGGGACGATCGTCG (SEQ ID NO:

19).

3. A pharmaceutical formulation comprising as an active ingredient an immunostimulatory oligonucleotide consisting of the base sequence GGGGGGGGGGACGATCGTCG (SEQ ID NO:

19), and further comprising an immunomodulating factor.

4. A pharmaceutical formulation according to claim 3 wherein said immunomodulating factor is an antigen or an adjuvant.