Probe, probe set, probe carrier, and testing method

• US 7,858,314 B2
• Filed: 05/13/2008
• Issued: 12/28/2010
• Est. Priority Date: 05/14/2007
• Status: Active Grant

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Shimizu, Nobuyoshi, Tomatsu, Nobuhiro, Fukui, Toshifumi, Takayanagi, Atsushi
• Primary Examiner(s): Navarro; Mark
• Assistant Examiner(s): PORTNER, VIRGINIA ALLEN
• Application Number:
  US12/119,970
• Publication Number:
  US 20080299570A1
• Time in Patent Office: 959 Days
• Field of Search: None
• US Class Current: 435/5
• CPC Class Codes: C12Q 1/6895 for plants, fungi or algae

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 3 and mutated sequences thereof.

Claims

1. A probe set for detecting a DNA of Trichophyton tonsurans which is a pathogenic fungus, comprising three probes consisting of the following base sequences (1) to (3) respectively to specifically detect Trichophyton tonsurans:

(1) cggcgagcctctctttatagcg (SEQ ID NO.

     1) or the complementary sequence thereof;

(2) cctctctttatagcggctcaacgc (SEQ ID NO.

     2) or the complementary sequence thereof; and

(3) ggctttctaggcgaatgggcaa (SEQ ID NO.

     3) or the complementary sequence thereof.

3. A kit for specifically detecting a DNA of Trichophyton tonsurans, comprising:

the probe set according to claim 1; and

a reagent for detecting a reaction of a probe with a target nucleic acid.

2. A probe set for detecting a DNA of Trichophyton tonsurans which is a pathogenic fungus, comprising the following probes (A) to (C), wherein the probe set does not comprise another probe to detect Trichophyton tonsurans:

(A) a probe consisting of cggcgagcctctctttatagcg (SEQ ID NO.

     1);

(B) a probe consisting of essentially of cctctctttatagcggctcaacgc (SEQ ID NO.

     2); and

(C) a probe consisting of ggctttctaggcgaatgggcaa (SEQ ID NO.

     3).

4. A kit for specifically detecting a DNA of Trichophyton tonsurans, comprising:

the probe set according to claim 2; and

a reagent for detecting a reaction of a probe with a target nucleic acid.