Compositions of CpG and saponin adjuvants and uses thereof
First Claim
Patent Images
1. A vaccine composition comprising:
- (a) an antigen;
(b) a Quillaja saponaria saponin possessing immune adjuvant activity; and
(c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide is not a part of a DNA vaccine vector,wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.
3 Assignments
0 Petitions
Accused Products
Abstract
Vaccine compositions of immunostimulatory oligonucleotides and saponin adjuvants and antigens and the use thereof for stimulating immunity, enhancing cell-mediated immunity, and enhancing antibody production are disclosed. Also described are immune adjuvant compositions comprising immunostimulatory oligonucleotides and saponin adjuvants, as well as methods for increasing an immune response using the same.
-
Citations
65 Claims
-
1. A vaccine composition comprising:
-
(a) an antigen; (b) a Quillaja saponaria saponin possessing immune adjuvant activity; and (c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide is not a part of a DNA vaccine vector, wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect. - View Dependent Claims (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 60, 61, 62, 63, 64, 65)
-
-
37. A vaccine composition comprising:
-
(a) an antigen; (b) a Quillaja saponaria saponin possessing immune adjuvant activity; and (c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the saponin is substantially pure, and the saponin is QS-7, QS-17, QS-18 or QS-21, and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect. - View Dependent Claims (38, 39)
-
-
40. A vaccine composition comprising:
-
(a) an antigen; (b) a Quillaja saponaria saponin possessing immune adjuvant activity; and (c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester, and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect. - View Dependent Claims (41)
-
-
42. A vaccine composition comprising:
-
(a) an antigen; (b) a Quillaja saponaria saponin possessing immune adjuvant activity; and (c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO;
1), and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect. - View Dependent Claims (43, 44, 45)
-
-
46. A vaccine composition comprising:
-
(a) an antigen; (b) a Quillaja saponaria saponin possessing immune adjuvant activity; and (c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide comprises TCCATGACGTTCCTGACGTT (SEQ ID NO;
2), and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect. - View Dependent Claims (47, 48, 49)
-
-
50. A vaccine composition comprising:
-
(a) an antigen; (b) a Quillaja saponaria saponin possessing immune adjuvant activity; and (c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide is 5-40 bases in length, and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect. - View Dependent Claims (51, 52, 53, 54)
-
-
55. A vaccine composition comprising:
-
(a) an antigen; (b) a Quillaja saponaria saponin possessing immune adjuvant activity, wherein the saponin is a chemically modified saponin; and (c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect. - View Dependent Claims (56, 57, 58, 59)
-
Specification