Compositions of CpG and saponin adjuvants and uses thereof

• US 7,858,589 B2
• Filed: 03/10/2006
• Issued: 12/28/2010
• Est. Priority Date: 08/10/1998
• Status: Expired due to Fees

• Current Assignee: Antigenics LLC (Agenus Inc.)
• Original Assignee: Antigenics Inc. (Agenus Inc.)
• Inventors: Kensil, Charlotte A.
• Primary Examiner(s): MINNIFIELD, NITA M
• Application Number:
  US11/373,806
• Publication Number:
  US 20060177458A1
• Time in Patent Office: 1,754 Days
• Field of Search: None
• US Class Current: 514/44.00R
• CPC Class Codes: A61K 2039/55561 CpG containing adjuvants; Oligonucleotide containing adjuvants
• CPC Class Codes: A61K 2039/55577 Saponins; Quil A; QS21; ISCOMS
• CPC Class Codes: A61K 39/095 Neisseria
• CPC Class Codes: A61K 39/39 characterised by the immunostimulating additives, e.g. chemical adjuvants
• CPC Class Codes: A61P 37/04 Immunostimulants
• CPC Class Codes: Y02A 50/30 Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

Vaccine compositions of immunostimulatory oligonucleotides and saponin adjuvants and antigens and the use thereof for stimulating immunity, enhancing cell-mediated immunity, and enhancing antibody production are disclosed. Also described are immune adjuvant compositions comprising immunostimulatory oligonucleotides and saponin adjuvants, as well as methods for increasing an immune response using the same.

Claims

1. A vaccine composition comprising:

(a) an antigen;

(b) a Quillaja saponaria saponin possessing immune adjuvant activity; and

(c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide is not a part of a DNA vaccine vector,

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

2. The vaccine composition as claimed in claim 1, wherein the saponin comprises a substantially pure saponin.

3. The vaccine composition as claimed in claim 2, wherein the substantially pure saponin is QS-7, QS-17, QS-18, or QS-21.

4. The vaccine composition as claimed in claim 3, wherein the substantially pure saponin is QS-21.

5. The vaccine composition as claimed in claim 1, wherein the immunostimulatory oligonucleotide is modified.

6. The vaccine composition as claimed in claim 1, wherein the immunostimulatory oligonucleotide is modified with at least one phosphorothioate-modified nucleotide.

7. The vaccine composition as claimed in claim 1, wherein the immunostimulatory oligonucleotide comprises a CpG motif having the formula 5′

X₁CGX₂3′

, wherein at least one nucleotide separates consecutive CpGs, and wherein X₁ is adenine, guanine, or thymine, and X₂ is cytosine, thymine, or adenine.

8. The vaccine composition as claimed in claim 7, wherein the CpG motif comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:

1) or TCCATGACGTTCCTGACGTT (SEQ ID NO;

2).

9. The vaccine composition as claimed in any one of claims 1 and 3-5, wherein the composition increases or induces an immune response to the antigen relative to the immune response to the antigen in the absence of said saponin and said immunostimulatory oligonucleotide when administered to a mammal.

10. The vaccine composition as claimed in any one of claims 1 and 3-5, wherein the composition increases or induces an immune response to the antigen relative to the immune response to the antigen in the absence of said saponin and said immunostimulatory oligonucleotide when administered to a human.

11. The vaccine composition as claimed in claim 1, wherein the composition enhances antibody production to the antigen relative to the antibody production to the antigen in the absence of said saponin and immunostimulatory oligonucleotide.

12. The vaccine composition as claimed in claim 11, wherein the composition enhances antibody production to the antigen in a positive synergistic manner.

13. The vaccine composition as claimed in claim 1, wherein the composition enhances cell-mediated immunity to the antigen relative to the cell-mediated immunity to the antigen in the absence of said saponin and immunostimulatory oligonucleotide.

14. The vaccine composition as claimed in claim 1, wherein the antigen comprises a protein, a peptide, a polysaccharide, a lipid, a glycolipid, or a phospholipid.

15. A method for stimulating immunity to an antigen in an individual comprising administering to said individual an effective amount of a vaccine composition as claimed in claim 1.

16. The method as claimed in claim 15, wherein the saponin comprises a substantially pure saponin.

17. The method as claimed in claim 16, wherein the substantially pure saponin is QS-7, QS-17, QS-18, or QS-21.

18. The method as claimed in claim 16, wherein the substantially pure saponin is QS-21.

19. The method as claimed in claim 15, wherein the immunostimulatory oligonucleotide is modified.

20. The method as claimed in claim 19, wherein the immunostimulatory oligonucleotide is modified with at least one phosphorothioate-modified nucleotide.

21. The method as claimed in claim 15, wherein the immunostimulatory oligonucleotide comprises a CpG motif having the formula 5′

X₁CGX₂3′

, wherein at least one nucleotide separates consecutive CpGs, and wherein X₁ is adenine, guanine, or thymine, and X₂ is cytosine, thymine, or adenine.

22. The method as claimed in claim 21, wherein the CpG motif comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:

1) or TCCATGACGTTCCTGACGTT (SEQ ID NO;

2).

23. The method as claimed in claim 15, wherein the composition increases or induces an immune response to the antigen relative to the immune response to the antigen in the absence of said saponin and said immunostimulatory oligonucleotide when administered to a mammal.

24. The method as claimed in claim 15, wherein the composition increases or induces an immune response to the antigen relative to the immune response to the antigen in the absence of said saponin and said immunostimulatory oligonucleotide when administered to a human.

25. The method as claimed in claim 15, wherein the composition increases or induces an immune response to the antigen relative to the immune response to the antigen in the absence of said saponin and said immunostimulatory oligonucleotide when administered to an animal.

26. The method as claimed in claim 15, wherein the method further enhances antibody production to the antigen relative to the antibody production to the antigen in the absence of said saponin and immunostimulatory oligonucleotide.

27. The method as claimed in claim 26, wherein the method further enhances antibody production to the antigen in a positive synergistic manner.

28. The method as claimed in claim 15, wherein the method further enhances cell-mediated immunity to the antigen relative to the cell-mediated immunity to the antigen in the absence of said saponin and immunostimulatory oligonucleotide.

29. The method as claimed in claim 15, wherein the antigen comprises a protein, a peptide, a polysaccharide, a lipid, a glycolipid, or a phospholipid.

30. The vaccine composition as claimed in claim 1, wherein the immunostimulatory oligonucleotide is 5-40 bases in length.

31. The vaccine composition as claimed in claim 5, wherein the composition increases or induces an immune response to the antigen relative to the immune response to the antigen in the absence of said saponin and said immunostimulatory oligonucleotide when administered to a mammal.

32. The vaccine composition as claimed in claim 5, wherein the composition increases or induces an immune response to the antigen relative to the immune response to the antigen in the absence of said saponin and said immunostimulatory oligonucleotide when administered to a human.

33. The vaccine composition as claimed in claim 14, wherein the antigen comprises a protein or a peptide.

34. The vaccine composition as claimed in claim 1, wherein the saponin is Quil-A.

35. The vaccine composition as claimed in claim 1, wherein the composition stimulates cell-mediated immunity in a positive synergistic manner.

36. The method as claimed in claim 29, wherein the antigen comprises a protein or a peptide.

60. The vaccine composition as claimed in claim 1, wherein the saponin is a chemically modified saponin.

61. The vaccine composition as claimed in claim 1 formulated for parenteral, intravenous, intramuscular, or subcutaneous administration.

62. The vaccine composition as claimed in any one of claim 1, 37, 40, 42, 46, 50, or 55, wherein the antigen is derived from a virus.

63. The vaccine composition as claimed in any one of claim 1, 37, 40, 42, 46, 50, or 55, wherein the antigen is derived from a bacterium.

64. The vaccine composition as claimed in any one of claim 1, 37, 40, 42, 46, 50, or 55, wherein the antigen is derived from a protozoan.

65. The vaccine composition as claimed in claim 64, wherein the protozoan is Plasmodium.

37. A vaccine composition comprising:

(a) an antigen;

(b) a Quillaja saponaria saponin possessing immune adjuvant activity; and

(c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the saponin is substantially pure, and the saponin is QS-7, QS-17, QS-18 or QS-21, and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

38. The vaccine composition as claimed in claim 37, wherein the substantially pure saponin is QS-21.

39. The vaccine composition as claimed in claim 37 or 38, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

40. A vaccine composition comprising:

(a) an antigen;

(b) a Quillaja saponaria saponin possessing immune adjuvant activity; and

(c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester, and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

41. The vaccine composition as claimed in claim 40, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:

1) or TCCATGACGTTCCTGACGTT (SEQ ID NO;

2).

42. A vaccine composition comprising:

(a) an antigen;

(b) a Quillaja saponaria saponin possessing immune adjuvant activity; and

(c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO;

1), and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

43. The vaccine composition as claimed in claim 42, wherein the saponin is substantially pure, and the saponin is QS-7, QS-17, QS-18 or QS-21.

44. The vaccine composition as claimed in claim 43, wherein the substantially pure saponin is QS-21.

45. The vaccine composition as claimed in any one of claims 42-44, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

46. A vaccine composition comprising:

(a) an antigen;

(b) a Quillaja saponaria saponin possessing immune adjuvant activity; and

(c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the immunostimulatory oligonucleotide comprises TCCATGACGTTCCTGACGTT (SEQ ID NO;

2), and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

47. The vaccine composition as claimed in claim 46, wherein the saponin is substantially pure, and the saponin is QS-7, QS-17, QS-18 or QS-21.

48. The vaccine composition as claimed in claim 47, wherein the substantially pure saponin is QS-21.

49. The vaccine composition as claimed in any one of claims 46-48, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

50. A vaccine composition comprising:

(a) an antigen;

(b) a Quillaja saponaria saponin possessing immune adjuvant activity; and

(c) an immunostimulatory oligonucleotide

comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide is 5-40 bases in length, and wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

51. The vaccine composition as claimed in claim 50, wherein the saponin is substantially pure, and the saponin is QS-7, QS-17, QS-18 or QS-21.

52. The vaccine composition as claimed in claim 51, wherein the substantially pure saponin is QS-21.

53. The vaccine composition as claimed in any one of claims 50-52, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

54. The vaccine composition as claimed in claim 50, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:

1) or TCCATGACGTTCCTGACGTT (SEQ ID NO;

2).

55. A vaccine composition comprising:

(a) an antigen;

(b) a Quillaja saponaria saponin possessing immune adjuvant activity, wherein the saponin is a chemically modified saponin; and

(c) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

56. The vaccine composition as claimed in claim 55, wherein the saponin is substantially pure, and the saponin is a chemically modified QS-7, QS-17, QS-18 or QS-21.

57. The vaccine composition as claimed in claim 56, wherein the substantially pure saponin is a chemically modified QS-21.

58. The vaccine composition as claimed in any one of claims 55-57, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

59. The vaccine composition as claimed in claim 55, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:

1) or TCCATGACGTTCCTGACGTT (SEQ ID NO;

2).