Probe, probe set, probe carrier, and testing method

• US 8,030,001 B2
• Filed: 03/02/2010
• Issued: 10/04/2011
• Est. Priority Date: 05/14/2007
• Status: Expired due to Fees

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Shimizu, Nobuyoshi, Tomatsu, Nobuhiro, Fukui, Toshifumi, Takayanagi, Atsushi
• Primary Examiner(s): Kim; Young J
• Application Number:
  US12/716,242
• Publication Number:
  US 20100240052A1
• Time in Patent Office: 581 Days
• Field of Search: None
• US Class Current: 435/6.12
• CPC Class Codes: C12Q 1/689 for bacteria

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof.

Claims

1. A detecting method to detect a nucleic acid of Candida albicans which is a pathogenic fungus comprising the steps of:

(i) reacting a sample with a probe carrier on which at least two probes selected from the following (A) to (D) are separately placed under a stringent condition; and

(ii) detecting a reaction intensity of probes on the probe carrier reacted with a nucleic acid contained in the sample and judging the presence of Candida albicans in the sample if the nucleic acid reacts with all of the at least two probes selected from (A) to (D);

(A) a probe consisting of the nucleotide sequence of tctttgaaacaaacttgctttggcgg (SEQ ID NO.

     1) or the fully complementary sequence thereof;

(B) a probe consisting of the nucleotide sequence of ccgccagaggtctaaacttacaacc (SEQ ID NO.

     2) or the fully complementary sequence thereof;

(C) a probe consisting of the nucleotide sequence of gacggtagtggtaaggcgggat (SEQ ID NO.

     3) or the fully complementary sequence thereof; and

(D) a probe consisting of the nucleotide sequence of ggcggtaacgtccaccacgtat (SEQ ID NO.

     4) or the fully complementary sequence thereof.

2. The detecting method of claim 1, wherein the nucleic acid of Candida albicans is specifically detected from the sample in which a fungus of Candida species other than Candida albicans or any one fungus selected from Trichosporon species, Cryptococcus species, Aspergillus species, Epidermophyton floccosum species, Arthroderma species or Trichophyton species might exist.

3. The detecting method of claim 2, wherein the nucleic acid of Candida albicans is specifically detected from the sample in which any one selected from Candida dubliniensis, Candida glabrata, Candida guilliermondii, Candida intermedia, Candida kefyr, Candida krusei, Candida lusitaniae, Candida parapsilosis, Candida tropicalis, Trichosporon cutaneum, Trichosporon asahii, Cryptococcus neoformans, Aspergillus fumigatus, Aspergillus niger, Epidermophyton floccosum, Arthroderma otae, Arthroderma gypseum, Arthroderma benhamiae, Trichophyton rubrum, Trichophyton tonsurans, Trichophyton verrucosum, Trichophyton violaceum, Arthroderma vanbreuseghemii, Arthroderma incurvatum or Trichophyton interdigitale might exist.

4. The detecting method of claim 1, wherein a kit is used to detect the nucleic acid of Candida albicans, wherein the kit comprises the probe carrier and a reagent to detect the nucleic acid of Candida albicans.