Probe, probe set, probe carrier, and testing method
First Claim
Patent Images
1. A method of detecting a DNA of Candida kefyr in a sample by using a probe carrier, comprising:
- (i) reacting the sample with the probe carrier; and
(ii) detecting a reaction intensity of a probe on the probe carrier reacted with a nucleic acid contained in the sample,wherein the probe carrier immobilizes a plurality of probes comprising four probes consisting of the following base sequences (1) to (4) respectively to specifically detect Candida kefyr;
(1) gcggccagttcttgattctctgc (SEQ ID NO.
1) or the complementary sequence thereof;
(2) agctcgtctctccagtggacataaac (SEQ ID NO.
2) or the complementary sequence thereof;
(3) ttgaaagtggctagccgttgcc (SEQ ID NO.
3) or the complementary sequence thereof; and
(4) tcgtggtaagcttgggtcatagagac (SEQ ID NO.
4) or the complementary sequence thereof.
0 Assignments
0 Petitions
Accused Products
Abstract
A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof.
61 Citations
1 Claim
-
1. A method of detecting a DNA of Candida kefyr in a sample by using a probe carrier, comprising:
-
(i) reacting the sample with the probe carrier; and (ii) detecting a reaction intensity of a probe on the probe carrier reacted with a nucleic acid contained in the sample, wherein the probe carrier immobilizes a plurality of probes comprising four probes consisting of the following base sequences (1) to (4) respectively to specifically detect Candida kefyr;
(1) gcggccagttcttgattctctgc (SEQ ID NO.
1) or the complementary sequence thereof;(2) agctcgtctctccagtggacataaac (SEQ ID NO.
2) or the complementary sequence thereof;(3) ttgaaagtggctagccgttgcc (SEQ ID NO.
3) or the complementary sequence thereof; and(4) tcgtggtaagcttgggtcatagagac (SEQ ID NO.
4) or the complementary sequence thereof.
-
Specification