Probe, probe set, probe carrier, and testing method

• US 8,153,371 B2
• Filed: 11/17/2010
• Issued: 04/10/2012
• Est. Priority Date: 05/14/2007
• Status: Active Grant

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Tomatsu, Nobuhiro, Fukui, Toshifumi, Shimizu, Nobuyoshi, Takayanagi, Atsushi
• Primary Examiner(s): KAPUSHOC, STEPHEN THOMAS
• Application Number:
  US12/948,724
• Publication Number:
  US 20110086358A1
• Time in Patent Office: 510 Days
• Field of Search: None
• US Class Current: 435/6.1
• CPC Class Codes: C12Q 1/6895 for plants, fungi or algae

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof.

Claims

1. A method of detecting a DNA of Candida kefyr in a sample by using a probe carrier, comprising:

(i) reacting the sample with the probe carrier; and

(ii) detecting a reaction intensity of a probe on the probe carrier reacted with a nucleic acid contained in the sample,

wherein the probe carrier immobilizes a plurality of probes comprising four probes consisting of the following base sequences (1) to (4) respectively to specifically detect Candida kefyr;

(1) gcggccagttcttgattctctgc (SEQ ID NO.

     1) or the complementary sequence thereof;

(2) agctcgtctctccagtggacataaac (SEQ ID NO.

     2) or the complementary sequence thereof;

(3) ttgaaagtggctagccgttgcc (SEQ ID NO.

     3) or the complementary sequence thereof; and

(4) tcgtggtaagcttgggtcatagagac (SEQ ID NO.

     4) or the complementary sequence thereof.