Probe, probe set, probe-immobilized carrier, and genetic testing method
First Claim
Patent Images
1. A probe set for detecting the internal transcribed spacer (ITS) region of the DNA of infectious disease pathogenic bacterium, Porphyromonas gingivalis, comprising three probes consisting of the following base sequences (1) to (3) respectively:
- (1) TTATAGCTGTAAGATAGGCATGCGTCCC (SEQ ID NO.
59) or the complementary sequence thereof;
(2) AACGGGCGATACGAGTATTGCATTGA (SEQ ID NO.
60) or the complementary sequence thereof; and
(3) ATATACCGTCAAGCTTCCACAGCGA (SEQ ID NO.
61) or the complementary sequence thereof.
1 Assignment
0 Petitions
Accused Products
Abstract
A nucleic acid probe for classification of pathogenic bacterial species is capable of collectively detecting bacterial strains of the same species and differentially detecting them from other bacterial species. Any one of the base sequences of SEQ ID NOS. 59 to 61 or a combination of at least two of them is used for detecting the gene of an infectious disease pathogenic bacterium.
28 Citations
13 Claims
-
1. A probe set for detecting the internal transcribed spacer (ITS) region of the DNA of infectious disease pathogenic bacterium, Porphyromonas gingivalis, comprising three probes consisting of the following base sequences (1) to (3) respectively:
-
(1) TTATAGCTGTAAGATAGGCATGCGTCCC (SEQ ID NO.
59) or the complementary sequence thereof;(2) AACGGGCGATACGAGTATTGCATTGA (SEQ ID NO.
60) or the complementary sequence thereof; and(3) ATATACCGTCAAGCTTCCACAGCGA (SEQ ID NO.
61) or the complementary sequence thereof. - View Dependent Claims (2, 3, 4, 5, 6, 7, 8, 12, 13)
-
-
9. A probe set for detecting the internal transcribed spacer (ITS) region of the DNA of infectious disease pathogenic bacterium, Porphyromonas gingivalis, comprising the following three probes (A) to (C), wherein the probe set does not comprise any other probes to detect the ITS region of the DNA of Porphyromonas gingivalis:
-
(A) a probe consisting of a base sequence of TTATAGCTGTAAGATAGGCATGCGTCCC (SEQ ID NO.
59);(B) a probe consisting of a base sequence of AACGGGCGATACGAGTATTGCATTGA (SEQ ID NO.
60); and(C) a probe consisting of a base sequence of ATATACCGTCAAGCTTCCACAGCGA (SEQ ID NO.
61). - View Dependent Claims (10, 11)
-
Specification