Methods of genetic analysis involving the amplification of complementary duplicons

• US 8,315,816 B2
• Filed: 02/16/2006
• Issued: 11/20/2012
• Est. Priority Date: 02/16/2005
• Status: Active Grant

• Current Assignee: Cy O'Connor Erade Village Foundation
• Original Assignee: Genetic Technologies Limited
• Inventors: Dawkins, Roger L., Millman, John Anthony, Williamson, Joseph Frederick
• Primary Examiner(s): Le, John H
• Application Number:
  US11/816,522
• Publication Number:
  US 20090150080A1
• Time in Patent Office: 2,469 Days
• Field of Search: 702/19, 702/20, 435/6, 435/91.2, 435/287.2, 435/69.1, 530/350
• US Class Current: 702/20
• CPC Class Codes: C12Q 1/6876 Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
• CPC Class Codes: G16B 10/00 ICT specially adapted for evolutionary bioinformatics, e.g. phylogenetic tree construction or analysis
• CPC Class Codes: G16B 30/00 ICT specially adapted for sequence analysis involving nucleotides or amino acids
• CPC Class Codes: G16B 30/10 Sequence alignment; Homology search

Abstract

The invention relates to methods for genetic analysis of DNA sequences containing complementary duplicons which are duplicated and linked DNA sequences separated by an intermediate sequence. Furthermore, the invention relates to the Bidirectional Amplification of Complementary Duplicons (BACD) using a single primer. The amplification of complementary duplicons can be used for a variety of purposes such as, determining the species from which a genomic DNA sample is derived, or used as a marker for a trait of interest. Also provided are methods for analyzing large datasets which can be used to identify primers useful for the genomic analysis methods of the invention.

Claims

1. A method of genetic analysis comprising:

i) amplifying a complementary duplicon(s) in genomic DNA in a sample from an individual; and

ii) generating a profile of amplification products from step i),

wherein the profile is characteristic of the genomic DNA, and wherein the amplification products are separated by size exclusion chromatography, and wherein the size exclusion chromatography is polyacrylamide gel electrophoresis.

2. The method of claim 1, wherein the profile is used to determine a species of the individual.

3. The method of claim 1, wherein the profile is used to determine a breed, strain or cultivar of the individual.

4. The method of claim 1, wherein the profile is used to determine whether the individual possess a particular trait.

5. The method of claim 4, wherein the trait is a disease or susceptibility thereto.

6. The method of claim 1, wherein the amplification is performed using a single primer.

7. The method of claim 1, wherein the sample comprises genomic DNA from a eukaryote.

8. A method of genetic analysis comprising:

i) obtaining a first nucleic acid sequence profile derived from amplification of a complementary duplicon(s) in genomic DNA in a sample from an individual,

ii) comparing the first nucleic acid sequence profile with one or more reference nucleic acid sequence profiles obtained by the amplification of the complementary duplicon(s) from one or more known species, and

iii) determining the species from which the sample is derived based on the similarity of the first nucleic acid sequence profile when compared to the reference nucleic acid sequence profiles.

9. The method of claim 8, wherein the individual is a hybrid of two species and the method determines parent species of the hybrid.

10. The method of claim 8, wherein the amplification products are separated by size exclusion chromatography.

11. The method of claim 10, wherein the size exclusion chromatography is either agarose gel electrophoresis or polyacrylamide gel electrophoresis.

12. The method of claim 11, wherein the size exclusion chromatography is polyacrylamide gel electrophoresis.

13. A method for detecting presence of, and/or quantifying an extent of, contaminating DNA in a sample comprising:

i) obtaining a first nucleic acid sequence profile derived from amplification of a complementary duplicon(s) in genomic DNA in a sample,

ii) comparing the first nucleic acid sequence profile with one or more reference nucleic acid sequence profiles obtained by the amplification of the complementary duplicon(s) from one or more known species,

iii) determining if the sample is derived from a single species based on the similarity of the first nucleic acid sequence profile when compared to the reference nucleic acid sequence profiles,

iv) if the sample comprises DNA from at least two different species, determining the two or more species from which the sample is derived based on the similarity of the first nucleic acid sequence profile when compared to the reference nucleic acid sequence profiles, and

v) optionally quantifying the relative concentration of the DNA from the two or more different species in the sample.

14. A method of estimating divergence times between two different species, breeds, cultivars or strains comprising:

i) obtaining a nucleic acid sequence profile representing a range of sizes derived from amplification of a complementary duplicon(s) in genomic DNA in a sample from an individual of each species, breed, cultivar or strain; and

ii) comparing the range of sizes derived from the amplification to determine an evolutionary relationship of the two species, breeds, cultivars or strains.

15. A composition comprising an oligonucleotide primer for use in amplifying a complementary duplicon comprising, a primer that can be used to generate a profile of amplification products characteristic of a genome of an animal wherein the primer is selected from the group consisting of:

a) an oligonucleotide comprising a sequence selected from the group consisting of;

ATGAGCTTGTCTACACCT (SEQ ID NO;

     1),

GGCACAATCGGTCCTACCAGAGCTA (SEQ ID NO;

     2),

GAGATCGAGACCATCCTGGCTAACAA (SEQ ID NO;

     3), and

CCGTGTTAGCCAGGATGGTCTCGAT (SEQ ID NO;

     8),

b) an oligonucleotide comprising a sequence which is a reverse complement of any oligonucleotide provided in a), and

c) a variant of a) or b) which hybridizes under amplification conditions to a same complementary duplicon as a) or b).

16. A composition comprising an oligonucleotide of claim 15, further comprising an acceptable carrier.