Probe, probe set, probe carrier, and testing method

• US 8,344,124 B2
• Filed: 04/23/2012
• Issued: 01/01/2013
• Est. Priority Date: 05/14/2007
• Status: Expired due to Fees

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Tomatsu, Nobuhiro, Fukui, Toshifumi, Shimizu, Nobuyoshi, Takayanagi, Atsushi
• Primary Examiner(s): Kim, Young J
• Application Number:
  US13/453,951
• Publication Number:
  US 20120219951A1
• Time in Patent Office: 253 Days
• Field of Search: None
• US Class Current: 536/24.33
• CPC Class Codes: C12Q 1/6895 for plants, fungi or algae

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 2 and mutated sequences thereof.

Claims

1. A probe set for detecting a DNA of Arthroderma vanbreuseghemii which is a pathogenic fungus, comprising two probes consisting of the following base sequences (A) and (B) respectively to specifically detect Arthroderma vanbreuseghemii:

(A) tctctttagtggctcaacgctgga (SEQ ID NO.

     1) or the fully complementary sequence thereof; and

(B) ggacagacgcaaaaaaattctttcagaag (SEQ ID NO.

     2) or the fully complementary sequence thereof.

2. A probe set for detecting a DNA of Arthroderma vanbreuseghemii which is a pathogenic fungus, comprising two probes consisting of the following base sequences (A) and (B) respectively, wherein the probe set does not comprise another probe to detect Arthroderma vanbreuseghemii:

(A) tctctttagtggctcaacgctgga (SEQ ID NO.

     1) or the fully complementary sequence thereof; and

(B) ggacagacgcaaaaaaattctttcagaag (SEQ ID NO.

     2) or the fully complementary sequence thereof.

3. A probe carrier, comprising the probe set according to claim 2, wherein:

the probes of the probe set are each immobilized on a carrier; and

the probes of the probe set are arranged at intervals.

4. A kit for specifically detecting a DNA of Arthroderma vanbreuseghemii, comprising:

the probe carrier according to claim 3; and

a reagent for detecting a reaction of a probe with a target nucleic acid.