Probe, probe set, probe carrier, and testing method
First Claim
Patent Images
1. A probe set for detecting a DNA of Arthroderma vanbreuseghemii which is a pathogenic fungus, comprising two probes consisting of the following base sequences (A) and (B) respectively to specifically detect Arthroderma vanbreuseghemii:
- (A) tctctttagtggctcaacgctgga (SEQ ID NO.
1) or the fully complementary sequence thereof; and
(B) ggacagacgcaaaaaaattctttcagaag (SEQ ID NO.
2) or the fully complementary sequence thereof.
0 Assignments
0 Petitions
Accused Products
Abstract
A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 2 and mutated sequences thereof.
60 Citations
4 Claims
-
1. A probe set for detecting a DNA of Arthroderma vanbreuseghemii which is a pathogenic fungus, comprising two probes consisting of the following base sequences (A) and (B) respectively to specifically detect Arthroderma vanbreuseghemii:
-
(A) tctctttagtggctcaacgctgga (SEQ ID NO.
1) or the fully complementary sequence thereof; and(B) ggacagacgcaaaaaaattctttcagaag (SEQ ID NO.
2) or the fully complementary sequence thereof.
-
-
2. A probe set for detecting a DNA of Arthroderma vanbreuseghemii which is a pathogenic fungus, comprising two probes consisting of the following base sequences (A) and (B) respectively, wherein the probe set does not comprise another probe to detect Arthroderma vanbreuseghemii:
-
(A) tctctttagtggctcaacgctgga (SEQ ID NO.
1) or the fully complementary sequence thereof; and(B) ggacagacgcaaaaaaattctttcagaag (SEQ ID NO.
2) or the fully complementary sequence thereof. - View Dependent Claims (3, 4)
-
Specification