Probe, probe set, probe carrier, and testing method

• US 8,568,983 B2
• Filed: 02/01/2010
• Issued: 10/29/2013
• Est. Priority Date: 05/14/2007
• Status: Expired due to Fees

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Tomatsu, Nobuhiro, Fukui, Toshifumi, Shimizu, Nobuyoshi, Takayanagi, Atsushi
• Primary Examiner(s): Kim, Young J
• Application Number:
  US12/698,074
• Publication Number:
  US 20100184073A1
• Time in Patent Office: 1,366 Days
• Field of Search: None
• US Class Current: 435/6.12
• CPC Class Codes: C12Q 1/6895 for plants, fungi or algae

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 3 and mutated sequences thereof.

Claims

1. A method of specifically detecting the internal transcribed spacer (ITS) region of DNA of Candida tropicalis which is a pathogenic fungus, comprising:

(i) reacting a sample with a probe carrier comprising the following three probes (A) to (C), which are immobilized on a carrier as arranged at intervals, under stringent conditions; and

(ii) detecting a reaction intensity of each probe on the probe carrier reacted with a nucleic acid contained in the sample to detect the internal transcribed spacer (ITS) region of DNA of Candida tropicalis that reacts with all of the three probes;

(A) a probe consisting of a base sequence represented by accgccagaggttataactaaaccaaa (SEQ ID NO.

     1) or the fully complementary sequence thereof;

(B) a probe consisting of a base sequence represented by gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO.

     2) or the fully complementary sequence thereof; and

(C) a probe consisting of a base sequence represented by acgcttattttgctagtggccacc (SEQ ID NO.

     3) or the fully complementary sequence thereof.

2. The method according to claim 1, wherein the method uses a kit for specifically detecting the internal transcribed spacer (ITS) region of DNA of Candida tropicalis, the kit comprising:

the probe carrier; and

a reagent for detecting a reaction between each of the three probes with a target nucleic acid.

3. The method according to claim 1, wherein the method specifically detects the internal transcribed spacer (ITS) region of DNA of Candida tropicalis, in a sample potentially containing Candida tropicalis, along with other Candida species, Trichosporon species, Cryptococcus species, Aspergillus species, Epidermophyton species, Arthroderma species, or Trichophyton species.

4. The method according to claim 3, wherein the method specifically detects the internal transcribed spacer (ITS) region of DNA of Candida tropicalis, in a sample potentially containing Candida tropicalis, along with Candida albicans (JCM 1542), Candida dubliniensis (ATCC MYA-646), Candida glabrata (JCM 3761), Candida guilliermondii (ATCC 6260), Candida intermedia (ATCC 14439), Candida kefyr (ATCC 42265), Candida krusei (JCM 1609), Candida lusitaniae (ATCC 34449), Candida parapsdosis (JCM 1618), Trichosporon cutaneum (JCM 1462), Trichosporon asahii (JCM 1809), Cryptococcus neoformans (ATCC 32045), Aspergillus fumigatus (JCM 10253), Aspergillus niger (JCM 10254), Epidermophyton floccosum (ATCC 52063), Arthroderma otae (ATCC 28327), Arthroderma gypseum (ATCC 24163), Arthroderma benhamiae (ATCC 16781), Trichophyton rubrum (ATCC 10218), Trichophyton tonsurans (ATCC 10217), Trichophyton verrucosum (ATCC 28203), Trichophyton violaceum (ATCC 28944), Arthroderma vanbreuseghemii (ATCC 28145), Arthroderma incurvatum (ATCC 24005), or Trichophyton interdigitale (IFM 55365).

5. The method according to claim 1, further comprising amplifying the nucleic acid in the sample by using a primer comprising tccgtaggtgaacctgcgg (SEQ ID NO. 4) and a primer comprising tcctccgcttattgatatgc (SEQ ID NO. 5).