Probe, probe set, probe carrier, and testing method

• US 8,778,664 B2
• Filed: 06/19/2012
• Issued: 07/15/2014
• Est. Priority Date: 05/14/2007
• Status: Expired due to Fees

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Tomatsu, Nobuhiro, Fukui, Toshifumi, Shimizu, Nobuyoshi, Takayanagi, Atsushi
• Primary Examiner(s): SITTON, JEHANNE SOUAYA
• Application Number:
  US13/527,332
• Publication Number:
  US 20130157898A1
• Time in Patent Office: 756 Days
• Field of Search: None
• US Class Current: 435/287.1
• CPC Class Codes: C12Q 1/689 for bacteria
• CPC Class Codes: C12Q 1/6895 for plants, fungi or algae

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof.

Claims

1. A probe carrier comprising:

a probe set for detecting a DNA of Candida glabrata which is a pathogenic fungus; and

a solid phase carrier on which the probe set is immobilized,

wherein the probe set comprises four probes consisting of the following base sequences (A) to (D) respectively;

(A) ggtgttttatcacacgactcgacact (SEQ ID NO.

     1) or the complementary sequence thereof;

(B) ggagttctcccagtggatgcaaac (SEQ ID NO.

     2) or the complementary sequence thereof;

(C) ggccatatcagtatgtgggacacg (SEQ ID NO.

     3) or the complementary sequence thereof; and

(D) aggttttaccaactcggtgttgatctag (SEQ ID NO.

     4) or the complementary sequence thereof.

2. The probe carrier according to claim 1, wherein the probe carrier does not comprise any other probe to detect Candida glabrata.

3. A kit for detecting a DNA of Candida glabrata, comprising:

the probe carrier according to claim 1; and

a reagent for detecting a reaction of any one of the four probes with a target nucleic acid.

4. A kit for detecting a DNA of Candida glabrata, comprising:

the probe carrier according to claim 2; and

a reagent for detecting a reaction of any one of the four probes with a target nucleic acid.

5. A kit according to claim 3, wherein the reagent contains a primer set for amplifying the DNA of Candida glabrata, and the primer set includes:

an oligonucleotide having a base sequence of tccgtaggtgaacctgcgg (SEQ ID NO.

     5); and

an oligonucleotide having a base sequence of tcctccgcttattgatatgc (SEQ ID NO.

     6).