×

Multiple exon skipping compositions for DMD

  • US 9,234,198 B1
  • Filed: 09/11/2015
  • Issued: 01/12/2016
  • Est. Priority Date: 10/24/2008
  • Status: Active Grant
First Claim
Patent Images

1. An antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

  • 385), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′

    -O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

    or a pharmaceutically acceptable salt thereof.

View all claims
  • 1 Assignment
Timeline View
Assignment View
    ×
    ×