Multiple exon skipping compositions for DMD

• US 9,234,198 B1
• Filed: 09/11/2015
• Issued: 01/12/2016
• Est. Priority Date: 10/24/2008
• Status: Active Grant

• Current Assignee: Sarepta Therapeutics, Inc.
• Original Assignee: Sarepta Therapeutics, Inc.
• Inventors: Sazani, Peter, Kole, Ryszard
• Primary Examiner(s): MCDONALD, JENNIFER SUE PITRAK
• Application Number:
  US14/852,257
• Publication Number:
  US 20150376617A1
• Time in Patent Office: 123 Days
• Field of Search: None
• US Class Current: 1/1
• CPC Class Codes: A61P 21/00 Drugs for disorders of the muscular or neuromuscular system
• CPC Class Codes: A61P 21/04 for myasthenia gravis
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/321 2'-O-R Modification
• CPC Class Codes: C12N 2310/3233 Morpholino-type ring
• CPC Class Codes: C12N 2310/331 Universal or degenerate base
• CPC Class Codes: C12N 2310/3341 5-Methylcytosine
• CPC Class Codes: C12N 2310/3513 Protein; Peptide
• CPC Class Codes: C12N 2320/30 Special therapeutic applications
• CPC Class Codes: C12N 2320/33 Alteration of splicing

Abstract

Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.

Claims

1. An antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

385), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′

-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

or a pharmaceutically acceptable salt thereof.

2. An antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

385), in which;

(i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′

-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

or a pharmaceutically acceptable salt thereof.

3. An antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

385), in which;

(i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′

-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

or a pharmaceutically acceptable salt thereof.

4. An antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

385), in which;

(i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′

-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

or a pharmaceutically acceptable salt thereof.

5. A pharmaceutical composition comprising an antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

385), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′

-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

6. A pharmaceutical composition comprising an antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

385), in which;

(i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′

-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

7. A pharmaceutical composition comprising an antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

385), in which;

(i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′

-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

8. A pharmaceutical composition comprising an antisense oligonucleotide of 22 bases comprising a base sequence that is 100% complementary to 22 consecutive bases of exon 52 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of CAGCGGTAATGAGTTCTTCCAACTG (SEQ ID NO:

385), in which;

(i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′

-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 52 skipping;

or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.