Probe, probe set, probe carrier, and testing method

• US 9,290,818 B2
• Filed: 10/18/2013
• Issued: 03/22/2016
• Est. Priority Date: 05/14/2007
• Status: Active Grant

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Tomatsu, Nobuhiro, Fukui, Toshifumi, Shimizu, Nobuyoshi, Takayanagi, Atsushi
• Primary Examiner(s): Kim, Young J
• Application Number:
  US14/058,075
• Publication Number:
  US 20140057806A1
• Time in Patent Office: 886 Days
• Field of Search: None
• US Class Current: 1/1
• CPC Class Codes: C12Q 1/6895 for plants, fungi or algae

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 3 and mutated sequences thereof.

Claims

1. A probe carrier comprising:

a probe set for detecting a DNA of Candida tropicalis which is a pathogenic fungus; and

a carrier on which the probe set is immobilized,

wherein the probe set comprises three probes consisting of the following base sequences (A) to (C) respectively to specifically detect Candida tropicalis;

(A) accgccagaggttataactaaaccaaa (SEQ ID NO.

     1) or the complementary sequence thereof;

(B) gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO.

     2) or the complementary sequence thereof; and

(C) acgcttattttgctagtggccacc (SEQ ID NO.

     3) or the complementary sequence thereof.

2. A probe carrier according to claim 1, wherein each of the three probes is immobilized on the carrier at a predetermined position by a covalent bond between a functional group bound to the terminal of the probe and a functional group introduced to the surface of the carrier.

3. A probe carrier according to claim 1, wherein each of the three probes is immobilized on the carrier at a predetermined position, and the probe set detects a DNA of Candida tropicalis in a sample applied to the probe carrier based on the strength of a hybridization reaction between each of the three probes and the DNA of Candida tropicalis.

4. A probe carrier comprising:

a probe set for detecting a DNA of Candida tropicalis which is a pathogenic fungus; and

a solid phase carrier on which the probe set is immobilized,

wherein the probe set comprises three probes consisting of the following base sequences (A) to (C) respectively, and the probe set does not comprise another probe to detect Candida tropicalis;

(A) accgccagaggttataactaaaccaaa (SEQ ID NO.

     1) or the complementary sequence thereof;

(B) gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO.

     2) or the complementary sequence thereof; and

(C) acgcttattttgctagtggccacc (SEQ ID NO.

     3) or the complementary sequence thereof.

5. A kit for specifically detecting a DNA of Candida tropicalis, comprising:

the probe carrier according to claim 4; and

a reagent for detecting a reaction of at least one of the three probes with a target nucleic acid.

6. A probe carrier comprising:

a probe set for detecting a DNA of Candida tropicalis which is a pathogenic fungus, comprising three probes consisting of the following base sequences (A) to (C) respectively;

(A) the complementary sequence of SEQ ID NO. 1;

(B) the complementary sequence of SEQ ID NO. 2; and

(C) the complementary sequence of SEQ ID NO. 3; and

a carrier on which the probe set is immobilized.

7. A composition for detecting a DNA of Candida tropicalis which is a pathogenic fungus comprising:

(i) a first probe comprising a functional group and an oligonucleotide sequence, wherein the oligonucleotide sequence of the first probe consists of an oligonucleotide consisting of accgccagaggttataactaaaccaaa (SEQ ID NO.

     1);

(ii) a second probe comprising a functional group and an oligonucleotide sequence, wherein the oligonucleotide sequence of the second probe consists of an oligonucleotide consisting of gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO.

     2); and

(iii) a third probe comprising a functional group and an oligonucleotide sequence, wherein the oligonucleotide sequence of the third probe consists of an oligonucleotide consisting of acgcttattttgctagtggccacc (SEQ ID NO.

     3);

wherein the nucleotide base at the end of each oligonucleotide sequence is bonded with the same carrier.