×

RNA interference in dermal and fibrotic indications

  • US 9,340,786 B2
  • Filed: 03/24/2011
  • Issued: 05/17/2016
  • Est. Priority Date: 03/24/2010
  • Status: Active Grant
First Claim
Patent Images

1. A double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs:

  • 2463 (GCACCUUUCUAGA), 3429 (G.mC. A.mC.mC.mU.mU.mU.mC.mU. A*mG*mA.TEG-Chl), 2443 (UUGCACCUUUCUAA), 3445 (mU.mU.G.mC.A.mC.mC.mU.mU.mU.mC.mU*mA* mA.TEG-Chl), 2465 (CCUUUCUAGUUGA), and 3469 (mC.mC.mU.mU.mU.mC.mU. A. G.mU.mU*mG*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs;

    2464 (UCUAGAAAGGUGCAAACAU), 3430 (P.mU.fC.fU. A. G.mA. A.mA. G. G.fU. G.mC* A* A* A*mC* A* U), 4203 (UUAGAAAGGUGCAAACAAGG), 3446 (P.mU.fU. A. G. A.mA. A. G. G.fU. G.fC.mA.mA*mA*fC*mA*mA*mG* G.), 2466 (UCAACUAGAAAGGUGCAAA), and 3470 (P.mU.fC. A. A.fC.fU. A. G. A.mA. A. G. G*fU*mG*fC*mA*mA* A.), wherein the dsRNA is an sd-rxRNA,wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′

    end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

View all claims
  • 6 Assignments
Timeline View
Assignment View
    ×
    ×