RNA interference in dermal and fibrotic indications

• US 9,340,786 B2
• Filed: 03/24/2011
• Issued: 05/17/2016
• Est. Priority Date: 03/24/2010
• Status: Active Grant

• Current Assignee: Phio Pharmaceuticals Corp.
• Original Assignee: Rxi Pharmaceuticals Corporation
• Inventors: Khvorova, Anastasia, Salomon, William, Kamens, Joanne, Samarsky, Dmitry, Woolf, Tod M., Pavco, Pamela A., Libertine, Lyn, Cardia, James, Bulock, Karen G.
• Primary Examiner(s): Bowman, Amy
• Application Number:
  US13/636,755
• Publication Number:
  US 20140113950A1
• Time in Patent Office: 1,881 Days
• US Class Current: 1/1
• CPC Class Codes: A61P 1/00 Drugs for disorders of the alimentary tract or the digestive system
• CPC Class Codes: A61P 1/16 for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• CPC Class Codes: A61P 11/00 Drugs for disorders of the respiratory system
• CPC Class Codes: A61P 13/00 Drugs for disorders of the urinary system
• CPC Class Codes: A61P 13/12 of the kidneys
• CPC Class Codes: A61P 15/00 Drugs for genital or sexual disorders for disorders of sex hormones A61P5/24; Contraceptives
• CPC Class Codes: A61P 17/00 Drugs for dermatological disorders
• CPC Class Codes: A61P 17/02 for treating wounds, ulcers, burns, scars, keloids, or the like
• CPC Class Codes: A61P 21/00 Drugs for disorders of the muscular or neuromuscular system
• CPC Class Codes: A61P 27/02 Ophthalmic agents
• CPC Class Codes: A61P 9/10 for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/1136 against growth factors, growth regulators, cytokines, lymphokines or hormones
• CPC Class Codes: C12N 2310/14 interfering N.A.
• CPC Class Codes: C12N 2310/315 Phosphorothioates
• CPC Class Codes: C12N 2310/321 2'-O-R Modification
• CPC Class Codes: C12N 2310/322 2'-R Modification
• CPC Class Codes: C12N 2310/3341 5-Methylcytosine
• CPC Class Codes: C12N 2310/351 Conjugate
• CPC Class Codes: C12N 2310/3515 Lipophilic moiety, e.g. cholesterol
• CPC Class Codes: C12N 2310/3521 : Methyl
• CPC Class Codes: C12N 2310/3533 : Halogen
• CPC Class Codes: C12N 2320/32 : Special delivery means, e.g. tissue-specific
• CPC Class Codes: C12N 2320/52 : modulating the physical stability, e.g. GC-content

Abstract

The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal and fibrotic applications.

Claims

1. A double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs:

2463 (GCACCUUUCUAGA), 3429 (G.mC. A.mC.mC.mU.mU.mU.mC.mU. A*mG*mA.TEG-Chl), 2443 (UUGCACCUUUCUAA), 3445 (mU.mU.G.mC.A.mC.mC.mU.mU.mU.mC.mU*mA* mA.TEG-Chl), 2465 (CCUUUCUAGUUGA), and 3469 (mC.mC.mU.mU.mU.mC.mU. A. G.mU.mU*mG*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs;

2464 (UCUAGAAAGGUGCAAACAU), 3430 (P.mU.fC.fU. A. G.mA. A.mA. G. G.fU. G.mC* A* A* A*mC* A* U), 4203 (UUAGAAAGGUGCAAACAAGG), 3446 (P.mU.fU. A. G. A.mA. A. G. G.fU. G.fC.mA.mA*mA*fC*mA*mA*mG* G.), 2466 (UCAACUAGAAAGGUGCAAA), and 3470 (P.mU.fC. A. A.fC.fU. A. G. A.mA. A. G. G*fU*mG*fC*mA*mA* A.), wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′

end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

2. The dsRNA of claim 1, wherein the sense strand comprises SEQ ID NO:

2463 (GCACCUUUCUAGA) and the antisense strand comprises SEQ ID NO;

2464 (UCUAGAAAGGUGCAAACAU).

3. The dsRNA of claim 1, wherein the sense strand comprises SEQ ID NO:

3429 (G.mC. A.mC.mC.mU.mU.mU.mC.mU. A*mG*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO;

3430 (P.mU.fC.fU. A. G.mA. A.mA. G. G.fU. G.mC* A* A* A*mC* A* U).

4. The dsRNA of claim 1, wherein the sense strand comprises SEQ ID NO:

2443 (UUGCACCUUUCUAA) and the antisense strand comprises SEQ ID NO;

4203 (UUAGAAAGGUGCAAACAAGG), the sense strand comprises SEQ ID NO;

3445 (mU.mU. G.mC. A.mC.mC.mU.mU.mU.mC.mU*mA*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO;

3446 (P.mU.fU. A. G. A.mA. A. G. G.fU. G.fC.mA.mA*mA*fC*mA*fC*mA*mA*mG* G.), the sense strand comprises SEQ ID NO;

2465 (CCUUUCUAGUUGA) and the antisense strand comprises SEQ ID NO;

2466 (UCAACUAGAAAGGUGCAAA) or the sense strand comprises SEQ ID NO;

3469 (mC.mC.mU.mU.mU.mC.mU. A. G.mU.mU*mG*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO;

3470 (P.mU.fC. A. A.fC.fU. A. G. A.mA. A. G. G*fU*mG*fC*mA*mA* A.).

5. The dsRNA of claim 1, wherein the dsRNA is hydrophobically modified and/or wherein the dsRNA is linked to a hydrophobic conjugate.

6. A composition comprising the dsRNA of claim 1, optionally wherein the composition comprises dsRNA directed against genes encoding for more than one protein.

7. The composition of claim 1 wherein the composition is formulated for delivery to the skin, for topical delivery, for intradermal injection and/or wherein the composition is in a neutral formulation.

8. A method comprising delivering the dsRNA of claim 1 to the skin of a subject in need thereof.

9. A method comprising,

administering to a subject in need thereof a therapeutically effective amount of a double stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs:

2463 (GCACCUUUCUAGA), 3429 (G.mC. A.mC.mC.mU.mU.mU.mC.mU. A*mG*mA.TEG-Chl), 2443 (UUGCACCUUUCUAA), 3445 (mU.mU. G.mC. A.mC.mC.mU.mU.mU.mC.mU*mA*mA.TEG-Chl), 2465 (CCUUUCUAGUUGA), and 3469 (mC.mC.mU.mU.mU.mC.mU. A. G.mU.mU*mG*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs;

2464 (UCUAGAAAGGUGCAAACAU), 3430 (P.mU.fC.fU. A. G.mA. A.mA. G. G.fU. G.mC* A* A* A*mC* A* U), 4203 (UUAGAAAGGUGCAAACAAGG), 3446 (P.mU.fU. A. G. A.mA. A. G. G.fU. G.fC.mA.mA*mA*fC*mA*mA*mG* G.), 2466 (UCAACUAGAAAGGUGCAAA), and 3470 (P.mU.fC. A. A.fC.fU. A. G. A.mA. A. G. G*fU*mG*fC*mA*mA* A.), wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′

end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

10. The method of claim 9, wherein the dsRNA is administered via intradermal injection or is administered locally to the skin.

11. The method of claim 9, wherein the dsRNA is hydrophobically modified and/or is linked to a hydrophobic conjugate.

12. A double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs:

2459 (GUGACCAAAAGUA) or 3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs;

2460 (UACUUUUGGUCACACUCUC) or 3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.), wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′

end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

13. The dsRNA of claim 12, wherein the sense strand comprises SEQ ID NO:

2459 (GUGACCAAAAGUA) and the antisense strand comprises SEQ ID NO;

2460 (UACUUUUGGUCACACUCUC), or the sense strand comprises SEQ ID NO;

3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO;

3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.).

14. The dsRNA of claim 12, wherein the dsRNA is hydrophobically modified and/or wherein the dsRNA is linked to a hydrophobic conjugate.

15. A composition comprising the dsRNA of claim 12, optionally wherein the composition comprises dsRNA directed against genes encoding for more than one protein.

16. The composition of claim 15 wherein the composition is formulated for delivery to the skin, for topical delivery, for intradermal injection and/or wherein the composition is in a neutral formulation.

17. A method comprising delivering the dsRNA of claim 12 to the skin of a subject in need thereof.

18. A method comprising,

administering to a subject in need thereof a therapeutically effective amount of a double stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs:

2459 (GUGACCAAAAGUA) or 3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs;

2460 (UACUUUUGGUCACACUCUC) or 3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.), wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′

end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

19. The method of claim 18, wherein the dsRNA is administered via intradermal injection or is administered locally to the skin.

20. The method of claim 18, wherein the dsRNA is hydrophobically modified and/or is linked to a hydrophobic conjugate.