Aptamers to 4-1BB and their use in treating diseases and disorders

• US 9,365,855 B2
• Filed: 11/19/2013
• Issued: 06/14/2016
• Est. Priority Date: 03/03/2010
• Status: Active Grant

• Current Assignee: SomaLogic Operating Co., Inc. (Somalogic Incorporated)
• Original Assignee: Somalogic Incorporated
• Inventors: Vaught, Jonathan, Resnicow, Daniel I., Waugh, Sheela, Wilcox, Sheri K., Schneider, Daniel J.
• Primary Examiner(s): SHIN, DANA H
• Application Number:
  US14/084,411
• Publication Number:
  US 20140081011A1
• Time in Patent Office: 938 Days
• Field of Search: None
• US Class Current: 1/1
• CPC Class Codes: A61K 31/7115 Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
• CPC Class Codes: A61P 25/00 Drugs for disorders of the nervous system
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 37/08 Antiallergic agents antiasthmatic agents A61P11/06; ophthalmic antiallergics A61P27/14
• CPC Class Codes: C07H 19/073 with 2-deoxyribosyl as the saccharide radical
• CPC Class Codes: C07H 19/10 with the saccharide radical esterified by phosphoric or polyphosphoric acids
• CPC Class Codes: C07H 21/04 with deoxyribosyl as saccharide radical
• CPC Class Codes: C12N 15/115 Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers

Abstract

The present disclosure relates generally to the field of nucleic acids and, more particularly, to aptamers capable of binding to 4-1BB; pharmaceutical compositions comprising such 4-1BB aptamers; and methods of making and using the same.

Claims

1. An aptamer comprising the sequence of SEQ ID NO:

14;

2. The aptamer of claim 1, wherein said modified pyrimidine is a C-5 modified pyrimidine and said modified cytidine is a C-5 modified cytidine.

3. The aptamer of claim 2, wherein said C-5 modified pyrimidine is selected from the group consisting of the C-5 modified pyrimidines of FIG. 3.

4. The aptamer of claim 2, wherein said C-5 modified pyrimidine is selected from the group consisting of 5-(N-benzylcarboxyamide)-2′

-deoxyuridine (BndU), 5-(N-isobutylcarboxyamide)-2′

-deoxyuridine (iBudU), 5-(N-tryptaminocarboxyamide)-2′

-deoxyuridine (TrpdU) and 5-(N-naphthylmethylcarboxyamide)-2′

-deoxyuridine (NapdU).

5. The aptamer of claim 2, wherein said C-5 modified pyrimidine is 5-(N-tryptaminocarboxyamide)-2′

-deoxyuridine (TrpdU).

6. The aptamer of claim 2, wherein said C-5 modified cytidine is 5-methylcytidine.

7. The aptamer of claim 1, wherein the aptamer binds to a 4-1BB protein.

8. The aptamer of claim 7, wherein the Kd of said aptamer-4-1BB protein interaction is 50 nM or less.

9. The aptamer of claim 7, wherein said aptamer has the ability to inhibit the binding of a 4-1BB protein to a 4-1BB receptor ligand (4-1BBL).

10. An aptamer that binds to a 4-1BB protein, the aptamer comprising a sequence having at least about 90% identity to a sequence selected from the group consisting of SEQ ID NOS:

4-13.

11. The aptamer of claim 10, wherein said aptamer has the ability to inhibit the binding of a 4-1BB to a 4-1BB receptor ligand (4-1BBL).

12. The aptamer of claim 10, wherein the sequence has at least about 91%, 92%, 93%, 94% or 95% identity to a sequence selected from the group consisting of SEQ ID NOS:

4-13.

13. A pharmaceutical composition comprising an aptamer having a sequence having at least about 90% identity to a sequence selected from the group consisting of SEQ ID NOS:

4-13, or a pharmaceutically acceptable salt thereof.

14. The pharmaceutical composition of claim 13, wherein the sequence has at least about 91%, 92%, 93%, 94% or 95% identity to a sequence selected from the group consisting of SEQ ID NOS:

4-13.

15. A pharmaceutical composition comprising an aptamer having the sequence of CCTGCACCCAGTGTCCCCGACGGGGCCCTCTAGCCGTACTCTGTAATGG CGGATGCTGACGGAGAGGAGGACGG (SEQ ID NO:

6);

or a pharmaceutically acceptable salt thereof.