Antisense oligonucleotides for inducing exon skipping and methods of use thereof

• US 9,422,555 B2
• Filed: 09/17/2015
• Issued: 08/23/2016
• Est. Priority Date: 06/28/2004
• Status: Active Grant

• Current Assignee: University of Western Australia
• Original Assignee: University of Western Australia
• Inventors: Wilton, Stephen Donald, Fletcher, Sue, McClorey, Graham
• Primary Examiner(s): Chong, Kimberly
• Application Number:
  US14/857,555
• Publication Number:
  US 20160002631A1
• Time in Patent Office: 341 Days
• Field of Search: None
• US Class Current: 1/1
• CPC Class Codes: A61P 21/00 Drugs for disorders of the muscular or neuromuscular system
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/315 Phosphorothioates
• CPC Class Codes: C12N 2310/321 2'-O-R Modification
• CPC Class Codes: C12N 2310/3233 Morpholino-type ring
• CPC Class Codes: C12N 2310/33 of the base
• CPC Class Codes: C12N 2310/3341 5-Methylcytosine
• CPC Class Codes: C12N 2310/3519 Fusion with another nucleic acid
• CPC Class Codes: C12N 2320/30 Special therapeutic applications
• CPC Class Codes: C12N 2320/33 Alteration of splicing

Abstract

An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202.

Claims

1. An antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO:

207), in which cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′

-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping;

or a pharmaceutically acceptable salt thereof.

2. An antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO:

207), wherein the antisense oligonucleotide is a 2′

-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping;

or a pharmaceutically acceptable salt thereof.

3. A pharmaceutical composition comprising:

(a) an antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO;

     207), in which cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′

-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping;

or a pharmaceutically acceptable salt thereof, and

(b) a pharmaceutically acceptable carrier.

4. A pharmaceutical composition comprising:

(a) an antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO;

     207), wherein the antisense oligonucleotide is a 2′

-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping;

or a pharmaceutically acceptable salt thereof, and

(b) a pharmaceutically acceptable carrier.