Multiple exon skipping compositions for DMD
First Claim
Patent Images
1. An antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof.
1 Assignment
0 Petitions
Accused Products
Abstract
Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.
221 Citations
8 Claims
-
1. An antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof.
- 527) in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′
-
2. An antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which;
(i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof.
- 527) in which;
-
3. An antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which;
(i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof.
- 527) in which;
-
4. An antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which;
(i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof.
- 527) in which;
-
5. A pharmaceutical composition comprising an antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
- 527) in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′
-
6. A pharmaceutical composition comprising the an antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which;
(i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
- 527) in which;
-
7. A pharmaceutical composition comprising the an antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which;
(i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
- 527) in which;
-
8. A pharmaceutical composition comprising the an antisense oligonucleotide of 24 bases comprising a base sequence that is 100% complementary to 24 consecutive bases of exon 55 of the human dystrophin pre-mRNA, wherein the base sequence comprises 20 consecutive bases of TCTATGAGTTTCTTCCAAAGCAGCC (SEQ ID NO:
- 527) in which;
(i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 55 skipping;
or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
- 527) in which;
Specification