Methods of differentiating stem cells by modulating MIR-124

• US 9,457,053 B2
• Filed: 11/26/2013
• Issued: 10/04/2016
• Est. Priority Date: 11/30/2012
• Status: Active Grant

• Current Assignee: Accelerated Biosciences Corp.
• Original Assignee: Accelerated Biosciences Corp.
• Inventors: Lee, Tony Tung-Yin, Lee, Jau-Nan, Lee, Yuta
• Primary Examiner(s): Singh, Anoop
• Assistant Examiner(s): Montanari, David A
• Application Number:
  US14/090,804
• Publication Number:
  US 20140170118A1
• Time in Patent Office: 1,043 Days
• Field of Search: 435/377
• US Class Current: 1/1
• CPC Class Codes: A61K 35/39 Pancreas; Islets of Langerhans Langerhans cells of epidermis A61K35/36
• CPC Class Codes: A61P 1/14 Prodigestives, e.g. acids, enzymes, appetite stimulants, antidyspeptics, tonics, antiflatulents
• CPC Class Codes: A61P 11/04 for throat disorders
• CPC Class Codes: A61P 13/00 Drugs for disorders of the urinary system
• CPC Class Codes: A61P 13/02 of urine or of the urinary tract, e.g. urine acidifiers
• CPC Class Codes: A61P 13/10 of the bladder
• CPC Class Codes: A61P 15/02 for disorders of the vagina
• CPC Class Codes: A61P 17/02 for treating wounds, ulcers, burns, scars, keloids, or the like
• CPC Class Codes: A61P 17/04 Antipruritics
• CPC Class Codes: A61P 25/02 for peripheral neuropathies
• CPC Class Codes: A61P 27/02 Ophthalmic agents
• CPC Class Codes: A61P 3/02 Nutrients, e.g. vitamins, minerals
• CPC Class Codes: A61P 3/04 Anorexiants; Antiobesity agents
• CPC Class Codes: A61P 3/10 for hyperglycaemia, e.g. antidiabetics
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: C12N 2501/115 Basic fibroblast growth factor (bFGF, FGF-2)
• CPC Class Codes: C12N 2501/65 MicroRNA
• CPC Class Codes: C12N 2506/025 from extra-embryonic cells, e.g. trophoblast, placenta
• CPC Class Codes: C12N 5/0605 Cells from extra-embryonic tissues, e.g. placenta, amnion, yolk sac, Wharton's jelly
• CPC Class Codes: C12N 5/0678 : Stem cells; Progenitor cells; Precursor cells
• CPC Class Codes: C12P 19/34 : Polynucleotides, e.g. nucleic acids, oligoribonucleotides
• CPC Class Codes: C12P 21/02 : having a known sequence of two or more amino acids, e.g. glutathione
• CPC Class Codes: G01N 33/5023 : on expression patterns
• CPC Class Codes: G01N 33/507 : Pancreatic cells
• CPC Class Codes: G01N 33/5073 : Stem cells

Abstract

Provided herein are methods of differentiating stem cells via modulating miR-124, and the differentiated cells thereby. Also provided herein are methods for the treatment of diseases using the differentiated cells.

Claims

1. A method of differentiating an isolated mammalian trophoblast stem cell, the method comprising contacting the isolated mammalian trophoblast stem cell with bFGF (basic fibroblast growth factor), 2-mercaptoethanol and nicotinamide, to induce differentiation of the isolated mammalian trophoblast stem cell to a pancreatic progenitor cell that expresses a marker selected from the group consisting of Ngn3, insulin, and a combination thereof, wherein the isolated mammalian trophoblast stem cell is from a human or a mouse.

2. The method of claim 1, wherein the isolated mammalian trophoblast stem cell is a human trophoblast stem cell (hTS cell).

3. The method of claim 1, wherein the method activates miR-124.

4. The method of claim 1, wherein the concentration of bFGF is no more than 100 ng/mL.

5. The method of claim 1, wherein the concentration of bFGF is from about 1 to about 100 ng/mL.

6. The method of claim 1, wherein the concentration of bFGF is about 10 ng/mL.

7. The method of claim 1, wherein the concentration of 2-mercaptoethanol is from about 0.1 to about 10 mmol/L.

8. The method of claim 7, wherein the concentration of 2-mercaptoethanol is about 1 mmol/L.

9. The method of claim 1, wherein the concentration of nicotinamide is from about 1 to about 100 mmol/L.

10. The method of claim 9, wherein the concentration of nicotinamide is about 10 mmol/L.

11. The method of claim 3, wherein the miR-124 is miR-124a.

12. The method of claim 3, wherein the miR-124 is homo sapiens miR-124a (hsa-miR-124a).

13. The method of claim 3, wherein the miR-124 is hsa-miR-124-5p (SEQ ID NO:

1;

CGUGUUCACAGCGGACCUUGAU) or a fragment thereof;

or hsa-miR-124-3p (SEQ ID NO;

2;

UAAGGCACGCGGUGAAUGCC) or a fragment thereof.

14. The method of any one of claim 1, 2, 3, 4-6, or 7-13, wherein the pancreatic progenitor cell expresses Ngn3.