MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE
First Claim
Patent Images
1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA, said method comprising providing an oligonucleotide of 20 to 50 nucleotides in length to a cell, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skipping of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO:
- 27) is capable of binding to said exon-internal sequence.
2 Assignments
0 Petitions
Accused Products
Abstract
The invention relates to oligonucleotides for inducing skipping of exon 55 of the dystrophin gene. The invention also relates to methods of inducing exon 55 skipping using the oligonucleotides.
62 Citations
26 Claims
-
1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA, said method comprising providing an oligonucleotide of 20 to 50 nucleotides in length to a cell, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skipping of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO:
- 27) is capable of binding to said exon-internal sequence.
- View Dependent Claims (3, 4, 5, 6, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26)
-
2. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) in a patient by inducing the skipping of exon 51 of the human dystrophin pre-mRNA, said method comprising providing an oligonucleotide of 20 to 50 nucleotides in length to a cell of said patient, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skippin of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO:
- 27) is capable of binding to said exon-internal sequence.
-
8. (canceled)
-
9. (canceled)
Specification