MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE

• US 20140275212A1
• Filed: 03/06/2014
• Published: 09/18/2014
• Est. Priority Date: 03/21/2003
• Status: Active Grant

• Current Assignee: Academisch Ziekenhuis Leiden
• Original Assignee: Academisch Ziekenhuis Leiden
• Inventors: van Deutekom, Judith Christina Theodora
• Granted Patent: US 10,190,116 B2
• Time in Patent Office: Days
• US Class Current: 514/44.A
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61K 48/0016 wherein the nucleic acid is delivered as a 'naked' nucleic acid, i.e. not combined with an entity such as a cationic lipid
• CPC Class Codes: A61P 21/00 Drugs for disorders of the muscular or neuromuscular system
• CPC Class Codes: A61P 21/04 for myasthenia gravis
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C07H 21/02 with ribosyl as saccharide radical
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/85 for animal cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/111 spanning the whole gene, or a large part of it
• CPC Class Codes: C12N 2310/31 of the backbone
• CPC Class Codes: C12N 2310/314 Phosphoramidates
• CPC Class Codes: C12N 2310/315 Phosphorothioates
• CPC Class Codes: C12N 2310/3181 Peptide nucleic acid, PNA
• CPC Class Codes: C12N 2310/321 2'-O-R Modification
• CPC Class Codes: C12N 2310/3231 having an additional ring, e.g. LNA, ENA
• CPC Class Codes: C12N 2310/3233 Morpholino-type ring
• CPC Class Codes: C12N 2310/346 having a combination of backbone and sugar modifications
• CPC Class Codes: C12N 2310/3521 Methyl
• CPC Class Codes: C12N 2320/30 : Special therapeutic applications
• CPC Class Codes: C12N 2320/33 : Alteration of splicing
• CPC Class Codes: C12Q 1/6883 : for diseases caused by alterations of genetic material
• CPC Class Codes: G01N 33/6887 : from muscle, cartilage or connective tissue

Abstract

The invention relates to oligonucleotides for inducing skipping of exon 55 of the dystrophin gene. The invention also relates to methods of inducing exon 55 skipping using the oligonucleotides.

Claims

1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA, said method comprising providing an oligonucleotide of 20 to 50 nucleotides in length to a cell, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skipping of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO:

27) is capable of binding to said exon-internal sequence.

3. The method of claim 1, wherein the cell is a muscle cell.

4. The method of claim 1, wherein the cell is from a subject with Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD).

5. The method of claim 1, wherein mRNA produced from skipping of exon 51 of the dystrophin pre-mRNA encodes a functional dystrophin protein or a dystrophin protein of a Becker Muscular Dystrophy patient.

6. The method of claim 1, wherein the oligonucleotide comprises DNA.

7. The method of claim 1, wherein the oligonucleotide comprises RNA.

10. The method of claim 1, wherein the oligonucleotide comprises a modification.

11. The method of claim 10, wherein the modification is selected from the group consisting of:

a morpholine ring, a 2′

-O-methyl ribose moiety, a phosphorothioate internucleoside linkage, a phosphorodiamidate internucleoside linkage, a peptide nucleic acid, and a locked nucleic acid.

12. The method of claim 11, wherein the oligonucleotide comprises a phosphorothioate internucleoside linkage.

13. The method of claim 12, wherein each internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

14. The method of claim 13, wherein the oligonucleotide is a 2′

-O-methyl phosphorothioate oligoribonucleotide.

15. The method of claim 11, wherein the modification is selected from the group consisting of a 2′

-O-methyl ribose moiety, a phosphorothioate internucleoside linkage and a locked nucleic acid.

16. The method of claim 11, wherein the oligonucleotide comprises a phosphorodiamidate internucleoside linkage.

17. The method of claim 16, wherein each internucleoside linkage of the oligonucleotide is a phosphorodiamidate internucleoside linkage.

18. The method of claim 17, wherein the oligonucleotide is a morpholino phosphorodiamidate oligonucleotide.

19. The method of claim 1, wherein the oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA and dystrophin expression in a muscle cell membrane upon transfection of human muscle cells with at least 100 nM of said oligonucleotide and incubation for at least 16 hours.

20. The method of claim 1, wherein exon 51 skipping is detected by RT-PCR and/or sequence analysis.

21. The method of claim 19, wherein dystrophin expression in a muscle cell membrane is detected by immunohistochemical and/or western blot analysis.

22. The method of claim 1, said exon internal sequence comprising a consecutive part of between 16 and 50 nucleotides of said exon and wherein said oligonucleotide is complementary to said consecutive part.

23. The method of claim 1, wherein said oligonucleotide is capable of binding without mismatches to said exon-internal sequence.

24. The method of claim 1, wherein the bases of said oligonucleotide consist of DNA bases or RNA bases.

25. The method of claim 1, said oligonucleotide being less than 50 nucleotides in length.

26. The method of claim 1, said oligonucleotide comprising a modification which confers increased resistance to RNAase H.

2. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) in a patient by inducing the skipping of exon 51 of the human dystrophin pre-mRNA, said method comprising providing an oligonucleotide of 20 to 50 nucleotides in length to a cell of said patient, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skippin of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO:

27) is capable of binding to said exon-internal sequence.

8. (canceled)

9. (canceled)