DNA Transfer vector and transformed microorganism containing human proinsulin and pre-proinsulin genes

• US 4,431,740 A
• Filed: 06/08/1982
• Issued: 02/14/1984
• Est. Priority Date: 09/12/1979
• Status: Expired due to Term

• Current Assignee: Regents of the University of California (University of California)
• Original Assignee: Regents of the University of California (University of California)
• Inventors: Rutter, William J., Goodman, Howard M., Pictet, Raymond, Bell, Graeme
• Primary Examiner(s): Tanenholtz, Alvin E.
• Application Number:
  US06/386,338
• Time in Patent Office: 616 Days
• Field of Search: 435/172, 435/253, 435/317
• US Class Current: 435/252.33
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: C12N 15/00 Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor mutants or genetically engineered microorganisms, per se C12N1/00, C12N5/00, C12N7/00; new plants per se A01H; plant reproduction by tissue culture techniques A01H4/00; new animals per se A01K67/00; use of medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases, gene therapy A61K48/00
• CPC Class Codes: C12P 21/02 having a known sequence of two or more amino acids, e.g. glutathione
• CPC Class Codes: Y10S 930/30 Signal or leader sequence

Abstract

A DNA having a base sequence coding for human proinsulin and a DNA having a base sequence coding for human pre-proinsulin have been cloned, and novel recombinant DNA transfer vectors containing said cloned DNAs have been constructed. Novel microorganisms transformed by said recombinant transfer vectors have been obtained. Certain of said transformed microorganisms have demonstrated capability to express the cloned DNA'"'"'s, synthesizing a protein comprising human proinsulin and a protein-comprising human pre-proinsulin.

Claims

1. A DNA transfer vector comprising an inserted cDNA consisting essentially of a deoxynucleotide sequence coding for human pre-proinsulin, the plus strand of said cDNA having a defined 5'"'"' end, said 5'"'"' end being the first deoxynucleotide of the sequence coding for said pre-proinsulin.

3. A microorganisms transformed by the transfer vector of claim 1 or 2.

2. A DNA transfer vector comprising an inserted cDNA consisting essentially of a deoxynucleotide sequence coding for human proinsulin, the plus strand of said cDNA having a defined 5'"'"' end, said 5'"'"' end being the first deoxynucleotide of the sequence coding for said proinsulin.

4. A DNA transfer vector comprising a deoxynucleotide sequence coding for human pre-proinsulin consisting essentially of a plus strand having the sequence:

5'"'"'-_-24 GCL_-23 X_-22 TY_-22 TGG_-21 ATG_-20 W_-19 GZ_-19 X_-18 TY_-18 X_-17 TY_-17 CCL_-16 X_-15 TY_-15 X_-14 TY_-14 GCL_-13 X_-12 TY_-12 X_-11 TY_-11 GCL_-10 X_-9 TY_-9 TGG_-8 GGL_-7 CCL_-6 GAK_-5 CCL_-4 GCL_-3 GCL_-2 GCL_-1 TTK₁ GTL₂ AAK₃ CAJ₄ CAK₅ X₆ TY₆ TGK₇ GGL₈ QR₉ S₉ CAK₁₀ X₁₁ TY₁₁ GTL₁₂ GAJ₁₃ GCL₁₄ X₁₅ TY₁₅ TAK₁₆ X₁₇ TY₁₇ GTL₁₈ TGK₁₉ GCL₂₀ GAJ₂₁ W₂₂ GZ₂₂ GCL₂₃ TTK₂₄ TTK₂₅ TAK₂₆ ACL₂₇ CCL₂₈ AAJ₂₉ ACL₃₀ W₃₁ GZ₃₁ W₃₂ GZ₃₂ GAJ₃₃ GCL₃₄ GAJ₃₅ GAK₃₆ X₃₇ TY₃₇ CAJ₃₈ GTL₃₉ GGL.sub. 40 CAJ₄₁ GTL₄₂ GAJ₄₃ X₄₄ TY₄₄ GGL₄₅ GGL₄₆ GGL₄₇ CCL₄₈ GGL₄₉ GCL₅₀ GGL₅₁ QR₅₂ S₅₂ X₅₃ TY₅₃ CAJ₅₄ CCL₅₅ X₅₆ TY₅₆ GCL₅₇ X₅₈ TY₅₈ GAJ₅₉ GGL₆₀ QR₆₁ S₆₁ X₆₂ TY₆₂ CAJ₆₃ AAJ₆₄ W₆₅ GZ₆₅ GGL₆₆ ATM₆₇ GTL₆₈ GAJ₆₉ CAJ₇₀ TGK₇₁ TGK₇₂ ACL₇₃ QR₇₄ S₇₄ ATM₇₅ TGK₇₆ QR₇₇ S₇₇ X₇₈ TY₇₈ TAK₇₉ CAJ₈₀ X₈₁ TY₈₁ GAJ₈₂ AAK₈₃ TAK₈₄ TGK₈₅ AAK₈₆ TAGACGCAGCCCGCAGGCAGCCCCCCACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGC poly A-3'"'"' wherein

A is deoxyadenyl,

G is deoxyguanyl,

C is deoxycytosyl,

T is thymidyl,

J is A or G;

K is T or C;

L is A, T, C, or G;

M is A, C or T;

X_n is T or C if Y_n is A or G; and

C if Y_n is C or T;

Y_n is A, G, C or T if X_n is C, and A or G if X_n is T;

W_n is C or A if Z_n is G or A, and C if Z_n is C or T;

Z_n is A, G, C or T if W_n is C, and A or G if W_n is A;

QR_n is TC if S_n is A, G, C or T, and AG if S_n is T or C;

S_n is A, G, C or T if QR_n is TC, and T or C if QR_n is AG; and

, subscript numerals, n, refer to the position in the amino acid sequence of human proinsulin, to which each triplet in the nucleotide sequence corresponds, according to the genetic code, the amino acid positions being numbered from the amino end.

6. A microorganism transformed by the transfer vector of claim 4 or 5.

12. The DNA transfer vector of claim 4 wherein:

J is A in amino acid positions 4, 13, 21, 69 and 70;

J is G in amino acid positions 29, 33, 34, 38, 41, 43, 54, 59, 63, 64, 80 and 82;

K is T in amino acid positions 1 and 72;

K is C in amino acid positions -5, 3, 5, 7, 10, 16, 19, 24, 25, 26, 36, 71, 76, 79, 83, 84, 85 and 86;

L is A in amino acid positions -7, -4, -2, 27, 34 and 50;

L is T in amino acid positions -6, 14, 48 and 49;

L is C in amino acid positions -23, -16, -10, -3, -1, 8, 23, 28, 30, 45, 47, 51, 55, 57, 66 and 73;

L is G in amino acid positions -13, 2, 12, 18, 20, 39, 40, 42, 46, 60 and 68;

M is C in amino acid position 75;

M is T in amino acid position 67;

X is T in amino acid position 56;

X is C in amino acid positions -22, -18, -17, -15, -14, -12, -11, -9, 6, 11, 15, 17, 37, 53, 58, 62, 78 and 81;

X is G in amino acid position 44;

Y is A in amino acid position 17;

Y is G in amino acid positions -22, -17, -15, -14, -12, -11, -9, 6, 11, 37, 44, 53, 56, 58, 62 and 81;

Y is C in amino acid positions -18, 15 and 78;

W is C in amino acid positions -19, 22, 31, 32 and 65;

Z is C in amino acid position -19;

Z is A in amino acid position 22;

Z is G in amino acid positions 31 and 32;

Z is T in amino acid position 65;

QR is TC in amino acid positions 9, 62 and 77;

QR is AG in amino acid positions 52 and 74;

S is A in amino acid position 9; and

S is C in amino acid positions 52, 61, 74 and 77.

5. A DNA transfer vector comprising a deoxynucleotide sequence coding for human proinsulin consisting essentially of a plus strand having the sequence:

5'"'"'-TTK₁ GTL₂ AAK₃ CAJ₄ CAK₅ X₆ TY₆ TGK₇ GGL₈ QR₉ S₉ CAK₁₀ X₁₁ TY₁₁ GTL₁₂ GAJ₁₃ GCL₁₄ X₁₅ TY₁₅ TAK₁₆ X₁₇ TY₁₇ GTL₁₈ TGK₁₉ GCL₂₀ GAJ₂₁ W₂₂ GZ₂₂ GCL₂₃ TTK₂₄ TTK₂₅ TAK₂₆ ACL₂₇ CCL₂₈ AAJ₂₉ ACL₃₀ W₃₁ GZ₃₁ W₃₂ GZ₃₂ GAJ₃₃ GCL₃₄ GAJ₃₅ GAK₃₆ X₃₇ TY₃₇ CAJ₃₈ GTL₃₉ GGL₄₀ CAJ₄₁ GTL₄₂ GAJ₄₃ X₄₄ TY₄₄ GGL₄₅ GGL₄₆ GGL₄₇ CCL₄₈ GGL₄₉ GCL₅₀ GGL₅₁ QR₅₂ S₅₂ X₅₃ TY₅₃ CAJ₅₄ CCL₅₅ X₅₆ TY₅₆ GCL₅₇ X₅₈ TY₅₈ GAJ₅₉ GGL₆₀ QR₆₁ S₆₁ X₆₂ TY₆₂ CAJ₆₃ AAJ₆₄ W₆₅ GZ₆₅ GGL₆₆ ATM₆₇ GTL₆₈ GAJ₆₉ CAJ₇₀ TGK₇₁ TGK₇₂ ACL₇₃ QR₇₄ S₇₄ ATM₇₅ TGK₇₆ QR₇₇ S₇₇ X₇₈ TY₇₈ TAK₇₉ CAJ₈₀ X₈₁ TY₈₁ GAJ₈₂ AAK₈₃ TAK₈₄ TGK₈₅ AAK₈₆ TAG-3'"'"' wherein

A is deoxyadenyl,

G is deoxyguanyl,

C is deoxycytosyl,

T is thymidyl,

J is A or G;

K is T or C;

L is A, T, C, or G;

M is A, C or T;

X_n is T or C if Y_n is A or G; and

C if Y_n is C or T;

Y_n is A, G, C or T if X_n is C, and A or G if X_n is T;

W_n is C or A if Z_n is G or A, and C if Z_n is C or T;

Z_n is A, G, C or T if W_n is C, and A or G if W_n is A;

QR_n is TC if S_n is A, G, C or T, and AG if S_n is T or C;

S_n is A, G, C or T if QR_n is TC, and T or C if QR_n is AG; and

, subscript numerals, n, refer to the position in the amino acid sequence of human proinsulin, to which each triplet in the nucleotide sequence corresponds, according to the genetic code, the amino acid positions being numbered from the amino end.

13. The DNA transfer vector of claim 5 wherein:

J is A in amino acid positions 4, 13, 21, 69 and 70;

J is G in amino acid positions 29, 33, 35, 38, 41, 43, 54, 59, 63, 64, 80 and 82;

K is T in amino acid positions 1 and 72;

K is C in amino acid positions 3, 5, 7, 10, 16, 19, 24, 25, 26, 36, 71, 76, 79, 83, 84, 85 and 86;

L is A in amino acid positions 27, 34 and 50;

L is T in amino acid positions 14, 48 and 49;

L is C in amino acid positions 8, 23, 28, 30, 45, 47, 51, 55, 57, 66 and 73;

L is G in amino acid positions 2, 12, 18, 20, 39, 40, 42, 46, 60 and 68;

M is C in amino acid position 75;

M is T in amino acid position 67;

X is T in amino acid position 56;

X is C in amino acid positions 6, 11, 15, 17, 37, 53, 58, 62, 78 and 81;

X is G in amino acid position 44;

Y is A in amino acid position 17;

Y is G in amino acid positions 6, 11, 37, 44, 53, 56, 58, 62 and 81;

Y is C in amino acid positions 15 and 78;

W is C in amino acid positions 22, 31, 32 and 65;

Z is A in amino acid position 22;

Z is G in amino acid positions 31 and 32;

Z is T in amino acid position 65;

QR is TC in amino acid positions 9, 62 and 77;

QR is AG in amino acid positions 52 and 74;

S is A in amino acid position 9; and

S is C in amino acid positions 52, 61, 74 and 77.

14. The DNA transfer vector of claim 5 wherein the codon for amino acid position one is preceded by 5'"'"'-ATG and

J is A in amino acid positions 13, 21, 69 and 70;

J is G in amino acid positions 4, 29, 33, 35, 38, 41, 43, 54, 59, 63, 64, 80 and 82;

K is T in amino acid positions 3, 7 and 72;

K is C in amino acid positions 1, 5, 10, 16, 19, 24, 25, 26, 36, 71, 76, 79, 83, 84, 85 and 86;

L is A in amino acid positions 27, 34, 50;

L is T in amino acid positions 8, 12, 14, 48 and 49;

L is C in amino acid positions 2, 23, 28;

7. The plasmid pcHI-1.

9. A microorganism transformed by the plasmid of claim 7 or 8.

10. A microorganism as in claim 9 wherein the organism is Escherichia coli.

11. The microorganism as in claim 10 wherein the organism is Escherichia coli HB-101.

8. The plasmid pcHP-1.

15. 45, 47, 51, 55, 57, 66 and 73;

L is G in amino acid positions 18, 20, 39, 40, 42, 46, 60 and 68;

M is C in amino acid position 75;

M is T in amino acid position 67;

X is T in amino acid position 56;

X is C in amino acid positions 6, 11, 15, 17, 37, 53, 58, 62, 78, and 81;

X is G in amino acid position 44;

Y is A in amino acid position 17;

Y is G in amino acid positions 37, 44, 53, 56, 58, 62, and 81;

Y is C in amino acid positions 11, 15 and 78;

Y is T in amino acid position 6;

W is C in amino acid positions 22, 31, 32 and 65;

Z is A in amino acid position 22;

Z is G in amino acid positions 31 and 32;

Z is T in amino acid position 65;

QR is TC in amino acid positions 9, 62 and 77;

QR is AG in amino acid positions 52 and 74

S is T in amino acid position 9; and

S is C in amino acid positions 52, 61, 74 and 77.