Phasmid display carrier pCANTAB5L

Phasmid display carrier pCANTAB5L

  • CN 100,457,910 C
  • Filed: 12/19/2002
  • Issued: 02/04/2009
  • Est. Priority Date: 12/19/2002
  • Status: Active Grant
First Claim
Patent Images

1. phagemid display carrier pCANTAB5L, form by the nucleotide fragments that inserts between phagemid pCANTAB5X and contained Sfi I and the Not I restriction enzyme site, it is characterized in that the nucleotide fragments of said insertion is respectively:

  • the nucleotide fragments TCTAGAGGCCTGTCGACGGTACC that contains Xba I, StuI, Sal I and Kpn I restriction enzyme site;

    The flexible peptide linker gene [G4S] 3 that inserts between Kpn I and Not I restriction enzyme site, the nucleotides sequence of [G4S] 3 is classified GGC GGT GGT as GGATCTGGT GGC GGT GGATCC GGT GGC GGC GGC AGT, wherein GGABe the intestinal bacteria rare codon of introducing.

View all claims
    ×
    ×

    Thank you for your feedback

    ×
    ×