A kind of mitten crab multielement high flux genetic marker system and genetic analysis method

A kind of mitten crab multielement high flux genetic marker system and genetic analysis method

  • CN 101,613,742 A
  • Filed: 04/24/2009
  • Published: 12/30/2009
  • Est. Priority Date: 04/24/2009
  • Status: Active Grant
First Claim
Patent Images

1. mitten crab multielement high flux genetic marker system, it is characterized in that:

  • described multielement high flux genetic marker system is plastosome sequence information system and microsatellite molecular marker system, and wherein the microsatellite molecular marker system is made up of the system 1 of 7 EST-SSR marks and the system 2 of 6 EST-SSR marks;

    System 1 is made up of 7 EST-SSR marks, and 7 pairs of primers of 7 EST-SSR marks of amplification are respectively NE5 (F;

    CGTGAATGCTGTAGTGTAAT;

    R;

    CACCAGAAATAATGAGGTTT);

    NE12(F:

    ATGACATTGATGCCTGACG;

    R:

    TGCCTTTATTGACCGAGAC);

    NE16(F:

    TTTCACATCCTCCACAGACA;

    R:

    GCCACAAGTACACCCAATCA);

    NE27(F:

    ACGGGAAATGGAACAGAT;

    R:

    TCCTTCCATCCTGAGTCC);

    NE46(F:

    ACTGCTGTTGTTGGTGGTC;

    R:

    CCTTAATCCGTTGCGTCA);

    NE48(F:

    AAAGGTCAGTTAATTTCTTGAT;

    R:

    TCTAGTGAAATGACATATTGGT);

    NE49(F:

    AGACCGCTGTTATGCTCCT;

    R:

    ATGGGAATGAAGGTTATGTATG);

    System 2 is made up of 6 EST-SSR marks, and 6 pairs of primers of 6 EST-SSR marks of amplification are respectively NE1 (F;

    CATTCCAAGTCTTGACCCC;

    R;

    CAGAGCCACAACACTAACG);

    NE18(F:

    TATTCAACATTTCAACAACGAT;

    R:

    GACGAGCGAAGAACTGGA);

    NE23(F:

    AGAGGCAAATGCGATAAAGA;

    R:

    CACGACAGACTTACCAGCAC);

    NE25(F:

    AGGAGGTGCGTAAGAGTGA;

    R:

    TTTCCTTCCATCCTGAGTC);

    NE26(F:

    ACGGGAAATGGAACAGAT;

    R:

    TCCTTCCATCCTGAGTCC);

    NE36(F:

    ATGTGGACTGCGGGAGA;

    R:

    GTGGTGGTAGGTTCGTCTGT)。

View all claims
    ×
    ×

    Thank you for your feedback

    ×
    ×