Small interfering RNA for treating psoriasis

Small interfering RNA for treating psoriasis

  • CN 102,071,202 A
  • Filed: 11/20/2009
  • Published: 05/25/2011
  • Est. Priority Date: 11/20/2009
  • Status: Active Application
First Claim
Patent Images

1. treat psoriatic siRNA (siRNA) for one kind, it is characterized in that having following sequence:

  • Target sequence;

    5 '"'"'-3 '"'"' aaggcccaactaaagtcagcaPositive-sense strand;

    5 '"'"'-3 '"'"' ggcccaacuaaagucagcaTTAntisense strand;

    3 '"'"'-5 '"'"' TTccggguugauuucagucgu

View all claims
    ×
    ×

    Thank you for your feedback

    ×
    ×