A kind of mycoplasma pneumoniae MP detection kit

A kind of mycoplasma pneumoniae MP detection kit

  • CN 103,060,451 B
  • Filed: 01/10/2013
  • Issued: 03/02/2016
  • Est. Priority Date: 01/10/2013
  • Status: Active Grant
First Claim
Patent Images

1. a mycoplasma pneumoniae MP detection kit, described test kit comprises nucleic acid releasing agent and PCR reaction solution, described nucleic acid releasing agent comprises Sha graceful 0.01 ~ 0.5mmol/L, Repone K 20 ~ 300mmol/L of ancient India, sodium laurylsulfonate 0.01 ~ 2% and ethanol 0.05 ~ 1%;

  • Comprise the upstream primer, downstream primer and the probe for target polynucleotide detection that increase for target polynucleotide in described PCR reaction solution, and be 5 '"'"'-CCCACTCGCTGAACTGTTAGAT-3 '"'"' for the upstream primer sequence of target polynucleotide;

    Downstream primer sequence for target polynucleotide is 5 '"'"'-GGGTAAACAAGCGGTTGAAGT-3 '"'"', and the probe sequence for target polynucleotide is 5 '"'"'-CTGACACTGGTCCACAAAGCGTGAA-3 '"'"';

    Also comprise interior mark in described test kit, described interior target sequence is 5 '"'"'-CCTCTAGCGCTGCGAATAGAACTTCCTCTGTTCAAGCCTTCCCTTTATACGCTCAA GCTGGTTCTTCTTCAAGGTTCAAGCAATAGAAACGGAGATCTAC-3 '"'"';

    The upstream primer, downstream primer and the probe that detect for interior mark is also comprised in described PCR reaction solution;

    Inside putting on trip primer sequence is 5 '"'"'-CCTCTAGCGCTGCGAATAGAA-3 '"'"', and interior mark downstream primer sequence is 5 '"'"'-GTAGATCTCCGTTTCTATTGCTTGA-3 '"'"', and interior mark probe sequence is 5 '"'"'-TCAAGCCTTCCCTTTATACGCTCAAGC-3 '"'"'.

View all claims
    ×
    ×

    Thank you for your feedback

    ×
    ×