Molecular marker of pure white Hypsizygus marmoreus Finc-W-247, its acquisition method and application

Molecular marker of pure white Hypsizygus marmoreus Finc-W-247, its acquisition method and application

CN
  • CN 103,289,998 B
  • Filed: 01/25/2013
  • Issued: 04/08/2015
  • Est. Priority Date: 01/25/2013
  • Status: Active Grant
First Claim
Patent Images

1. a molecule marker of pure white Hypsizygus marmoreus Finc-W-247, is characterized in that:

  • specific PCR amplimer to sequence be 5'"'"'-GACGACGTTTGTGGGGTGA-3'"'"' and5'"'"'-AGGGAGATCGACGTCCATATTG-3'"'"', DNA fragmentation size is 975bp;

    Wherein, the concrete sequence of the molecule marker of described Finc-W-247 is;

    5'"'"'-gacgacgtttgtggggtgaacgatcccgaattgcaggatcccctcctccaatcacaatatgaaggcttgccatttctgccgtgagtcgacctgtttgggaaaaatcagaaagcgccactcatcttcatcgttcacctttcttttatagcggcaaatgttccatctacgggtggagcaccaagcagagcatcgtacctgggtggacgatgttctctaagtgggggaagcaaaacccaaatttgaatgtggggtatgtcgctgaggctattaatgtaaagcaatcctgacgctttccaggctcgcggttcagagcttgaaattcgttcgatcggggcgttatgtcaatcccagccgaattgcaccccttcatctctcaactcgagttgtttacggtagcgccgacaccaggcgccttcataccagtggaggctctgccatatgcgtctctaccatcttctccgcagagtctcttctcgtcaacggcagagagcagggtatggcgcaaaaacttctctccggcatatttcacagtcaagagtggcagcgcttcgaagctatgatgtgcttggcttttactcaccgccgattgaaagcgcagtacaacaatcatgctttggacttttgcacaaggcccagaccccaaggaaagtctcccgccctttgctatacgcttttttctttccgcggttgttcaaaagcagtggcttaacctgttctttccatagatgccaccagctcctccgtcggttccaagttcagcgctgccgacggaatgttcggggcggcgcccgccaaaggaaaagcggagtccagtcacgggcactcccctgttacaaacaagcctgtcctggattttgacgatgaaggtcacttcccctttcatgatctgcgtagaatcatactcatccatgttcgtttccagtacctgtctttgatgggcgtaacaccaccatcaatatggacgtcgatctccct-3'"'"'。

View all claims
    ×
    ×

    Thank you for your feedback

    ×
    ×