Optimized expression cassette for expressing a polypeptide with high yield

Optimized expression cassette for expressing a polypeptide with high yield

  • CN 104,968,791 A
  • Filed: 11/18/2013
  • Published: 10/07/2015
  • Est. Priority Date: 11/20/2012
  • Status: Active Application
First Claim
Patent Images

1. express an expression cassette for target polypeptides, described expression cassette comprises:

  • A) promotor;

    B) 5 '"'"' UTR polynucleotide sequence, wherein said 5 '"'"' UTR polynucleotide sequence is selected from lower groupI) 5 '"'"' UTR polynucleotide sequence of following sequence is comprisedagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagagtctataggcccacccccttggcttcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactatagaataacatccactttgcctttctctccacaggtgtccactcccaggtccaactgca(SEQ ID NO

         1);

    Ii) 5 '"'"' UTR polynucleotide sequence of following sequence is comprisedagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagagtctataggcccacccccttggcttcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactatagaataacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcacctcggttctatcg(SEQ ID NO

         2);

    Iii) 5 '"'"' UTR polynucleotide sequence of following sequence is comprisedagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagagtctataggcccacccccttggcttcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactatagaataacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcacctcggttctatcgaaaacgcgtccacc(SEQ ID NO

         3);

    Iv) 5 '"'"' UTR polynucleotide sequence of following sequence is comprisedagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagagtctataggcccacccccttggcttcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactatagaataacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcacctcggttctatcgcgattgaattccccggggatcctctagggtgaccgtttggtgccgccacc(SEQ ID NO

         4);

    V) 5 '"'"' UTR polynucleotide sequence of following sequence is comprisedagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagagtctataggcccacccccttggcttcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactatagaataacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcacctcggttctatcgaaaacgcgcctctagagccgccacc(SEQ ID NO

         5);

    Vi) 5 '"'"' UTR polynucleotide sequence of following sequence is comprisedagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagagtctataggcccacccccttggcttcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactatagaataacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcacctcggttctatcgaaaaacgcgtgccgccacc(SEQ ID NO

         6);

    Vii) 5 '"'"' UTR polynucleotide sequence of following sequence is comprisedagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagagtctataggcccacccccttggcttcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactatagaataacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcacctcggttctatcgaaaacgcgtgccgccacc(SEQ ID NO

         7);

    Viii) protection and sequence at least 85% shown in SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6 or SEQ ID NO 7, preferably 5 '"'"' UTR polynucleotide sequence of at least 90% same sequence;

    C) hCD33 that encodes secretes the polynucleotide of property leader sequence;

    WithD) polynucleotide of encoding target polypeptide or the insertion point for the polynucleotide that insert encoding target polypeptide.

View all claims
    ×
    ×

    Thank you for your feedback

    ×
    ×