Probe for detecting matrilinear inheritance chondriosome deafness gene A1555G and its use

Probe for detecting matrilinear inheritance chondriosome deafness gene A1555G and its use

  • CN 1,987,462 B
  • Filed: 12/26/2006
  • Issued: 03/25/2015
  • Est. Priority Date: 12/26/2006
  • Status: Active Grant
First Claim
Patent Images

1. one kind is detected the test kit of matrilinear inheritance chondriosome deafness gene A 1555 G, it is characterized in that:

  • comprise the reagent extracting blood sample DNA, pcr amplification reaction reagent mixed liquor, the forward primer of real time fluorescent quantitative probe and the described real time fluorescent quantitative probe of amplification and reverse primer, the nucleotide sequence of described real time fluorescent quantitative probe is arranged in the 1548-1569bp region as shown in matrilinear inheritance chondriosome deafness gene sequence SEQ ID NO;

    5, namely the nucleotide sequence AGAGGAGGCAAGTCGTAACA TG as shown in SEQ ID NO;

    1, and at 5 '"'"' end mark fluorescent reporter group of real time fluorescent quantitative probe fragment, 3 '"'"' end mark fluorescent quenching group, be referred to as saltant type real time fluorescent quantitative probe, described forward primer (F1) is the 1467-1483bp nucleotide sequence shown in matrilinear inheritance chondriosome deafness gene sequence SEQ ID NO;

    5, namely the nucleotide sequence CTGAAGCGCG TACACAC as shown in SEQIDNO;

    3, reverse primer (R1) is then the nucleotide sequence of the 1650-1668bp shown in matrilinear inheritance chondriosome deafness gene sequence SEQ ID NO;

    5, the nucleotide sequence AGAGCGGTCA AGTTAAGTT namely as shown in SEQ ID NO;

    4.

View all claims
    ×
    ×

    Thank you for your feedback

    ×
    ×